MAGP1 (MFAP2) (NM_001135248) Human Untagged Clone

CAT#: SC324767

MFAP2 (untagged)-Human microfibrillar-associated protein 2 (MFAP2), transcript variant 4



  "NM_001135248" in other vectors (4)

CNY 3,990.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
MFAP2 rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms MAGP; MAGP-1; MAGP1
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001135248, the custom clone sequence may differ by one or more nucleotides
ATGAGAGCTGCCTACCTCTTCCTGCTATTCCTGCCTGGCTTGCTGGCTCAGGGCCAGTAT
GACCTGGACCCGCTGCCGCCGTTCCCTGACCACGTCCAGTACACCCACTATAGCGACCAG
ATCGACAACCCAGACTACTATGATTATCAAGAGGTGACTCCTCGGCCCTCCGAGGAACAG
TTCCAGTTCCAGTCCCAGCAGCAAGTCCAACAGGAAGTCATCCCAGCCCCAACCCCAGAA
CCAGGAAATGCAGAGCTGGAGCCCACAGAGCCTGGGCCTCTTGACTGCCGTGAGGAACAG
TACCCGTGCACCCGCCTCTACTCCATACACAGGCCTTGCAAACAGTGTCTCAACGAGGTC
TGCTTCTACAGCCTCCGCCGTGTGTACGTCATTAACAAGGAGATCTGTGTTCGTACAGTG
TGTGCCCATGAGGAGCTCCTCCGAGCTGACCTCTGTCGGGACAAGTTCTCCAAATGTGGC
GTGATGGCCAGCAGCGGCCTGTGCCAATCCGTGGCGGCCTCCTGTGCCAGGAGCTGTGGG
AGCTGC
Restriction Sites Please inquire     
ACCN NM_001135248
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001135248.1, NP_001128720.1
RefSeq Size 1121 bp
RefSeq ORF 549 bp
Locus ID 4237
UniProt ID P55001
Protein Families Secreted Protein
Gene Summary Microfibrillar-associated protein 2 is a major antigen of elastin-associated microfibrils and a candidate for involvement in the etiology of inherited connective tissue diseases. Four transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Sep 2008]
Transcript Variant: This variant (4) uses an alternate in-frame splice site compared to variant 2. The resulting isoform (b) has the same N- and C-termini but is one aa shorter compared to isoform a. Variants 3 and 4 both encode isoform b.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...