United States
Germany
Japan
United Kingdom
China
MYL12B (NM_001144944) Human Untagged Clone
CAT＃: SC324759
MYL12B (untagged)-Human myosin, light chain 12B, regulatory (MYL12B), transcript variant 1
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | MLC-B; MRLC2 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_001144944 edited
GGTGTTTGGCGTCGGAATTAAACAACCACCATGTCGAGCAAAAAGGCAAAGACCAAGACC ACCAAGAAGCGCCCTCAGCGTGCAACATCCAATGTGTTTGCCATGTTTGACCAGTCACAG ATTCAGGAGTTCAAAGAGGCCTTCAACATGATTGATCAGAACAGAGATGGCTTCATCGAC AAGGAAGATTTGCATGATATGCTTGCTTCTCTAGGGAAGAATCCCACTGATGCATACCTT GATGCCATGATGAATGAGGCCCCAGGGCCCATCAATTTCACCATGTTCCTGACCATGTTT GGTGAGAAGTTAAATGGCACAGATCCTGAAGATGTCATCAGAAACGCCTTTGCTTGCTTT GATGAAGAAGCAACAGGCACCATTCAGGAAGATTACCTAAGAGAGCTGCTGACAACCATG GGGGATCGGTTTACAGATGAGGAAGTGGATGAGCTGTACAGAGAAGCACCTATTGACAAA AAGGGGAATTTCAATTACATCGAGTTCACACGCATCCTGAAACATGGAGCCAAAGACAAA GATGACTGAAAGAACTTTAGCTAAAATCTTCCAGTTACATTGTCTTACTCTCTTTTACTT CTCAGACACTTCCCCCACCCTCATAGAACCTGTTGCATGCAACTTAGTTTCACAGCTTTG CCTCTTCTTTTTGATGTATTTATTCCAGACCTTTCTGCCACTTAGCACTTGTATAATCAG ACTGGAAATGGGGATGAGGGTGTAAATTGTATTGAAAAAGATCGCGAATAAAAATCAACA AATGTGAAAGCCCAGAAAAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_001144944 |
| Insert Size | 800 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001144944.1, NP_001138416.1 |
| RefSeq Size | 1041 bp |
| RefSeq ORF | 519 bp |
| Locus ID | 103910 |
| UniProt ID | O14950 |
| Protein Pathways | Focal adhesion, Leukocyte transendothelial migration, Regulation of actin cytoskeleton, Tight junction |
| Gene Summary | The activity of nonmuscle myosin II (see MYH9; MIM 160775) is regulated by phosphorylation of a regulatory light chain, such as MRLC2. This phosphorylation results in higher MgATPase activity and the assembly of myosin II filaments (Iwasaki et al., 2001 [PubMed 11942626]).[supplied by OMIM, Mar 2008] Transcript Variant: This variant (1) represents the longest transcript. Variants 1-3 all encode the same protein. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC226973 | MYL12B (Myc-DDK-tagged)-Human myosin, light chain 12B, regulatory (MYL12B), transcript variant 1 |
CNY 2,400.00 |
|
| RC226973L1 | Lenti ORF clone of Human myosin, light chain 12B, regulatory (MYL12B), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC226973L2 | Lenti ORF clone of Human myosin, light chain 12B, regulatory (MYL12B), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
| RC226973L3 | Lenti ORF clone of Human myosin, light chain 12B, regulatory (MYL12B), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC226973L4 | Lenti ORF clone of Human myosin, light chain 12B, regulatory (MYL12B), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
| RG226973 | MYL12B (tGFP-tagged) - Human myosin, light chain 12B, regulatory (MYL12B), transcript variant 1 |
CNY 4,000.00 |
