United States
Germany
Japan
United Kingdom
China
FGF1 (NM_001144934) Human Untagged Clone
CAT＃: SC324744
FGF1 (untagged)-Human fibroblast growth factor 1 (acidic) (FGF1), transcript variant 5
CNY 1,800.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | AFGF; ECGF; ECGF-beta; ECGFA; ECGFB; FGF-1; FGF-alpha; FGFA; GLIO703; HBGF-1; HBGF1 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>NCBI ORF sequence for NM_001144934, the custom clone sequence may differ by one or more nucleotides
ATGGCTGAAGGGGAAATCACCACCTTCACAGCCCTGACCGAGAAGTTTAATCTGCCTCCAGGGAATTACA AGAAGCCCAAACTCCTCTACTGTAGCAACGGGGGCCACTTCCTGAGGATCCTTCCGGATGGCACAGTGGA TGGGACAAGGGACAGGAGCGACCAGCACATTCAGCTGCAGCTCAGTGCGGAAAGCGTGGGGGAGGTGTAT ATAAAGAGTACCGAGACTGGCCAGTACTTGGCCATGGACACCGACGGGCTTTTATACGGCTCACAGACAC CAAATGAGGAATGTTTGTTCCTGGAAAGGCTGGAGGAGAACCATTACAACACCTATATATCCAAGAAGCA TGCAGAGAAGAATTGGTTTGTTGGCCTCAAGAAGAATGGGAGCTGCAAACGCGGTCCTCGGACTCACTAT GGCCAGAAAGCAATCTTGTTTCTCCCCCTGCCAGTCTCTTCTGATTAA |
| Restriction Sites | Please inquire |
| ACCN | NM_001144934 |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001144934.1, NP_001138406.1 |
| RefSeq Size | 3875 bp |
| RefSeq ORF | 468 bp |
| Locus ID | 2246 |
| UniProt ID | P05230 |
| Protein Families | Druggable Genome, Secreted Protein |
| Protein Pathways | MAPK signaling pathway, Melanoma, Pathways in cancer, Regulation of actin cytoskeleton |
| Gene Summary | The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. This protein functions as a modifier of endothelial cell migration and proliferation, as well as an angiogenic factor. It acts as a mitogen for a variety of mesoderm- and neuroectoderm-derived cells in vitro, thus is thought to be involved in organogenesis. Multiple alternatively spliced variants encoding different isoforms have been described. [provided by RefSeq, Jan 2009] Transcript Variant: This variant (5) differs in the 5' UTR compared to variant 1. Variants 1, 4-7, 9-12, and 15-20 encode the same isoform (1). |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC227790 | FGF1 (Myc-DDK-tagged)-Human fibroblast growth factor 1 (acidic) (FGF1), transcript variant 5 |
CNY 1,800.00 |
|
| RC227790L3 | Lenti-ORF clone of FGF1 (Myc-DDK-tagged)-Human fibroblast growth factor 1 (acidic) (FGF1), transcript variant 5 |
CNY 5,890.00 |
|
| RC227790L4 | Lenti-ORF clone of FGF1 (mGFP-tagged)-Human fibroblast growth factor 1 (acidic) (FGF1), transcript variant 5 |
CNY 5,890.00 |
|
| RG227790 | FGF1 (tGFP-tagged) - Human fibroblast growth factor 1 (acidic) (FGF1), transcript variant 5 |
CNY 4,370.00 |
