RAB7L1 (RAB29) (NM_001135664) Human Untagged Clone
CAT#: SC324724
RAB7L1 (untagged)-Human RAB7, member RAS oncogene family-like 1 (RAB7L1), transcript variant 4
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | RAB7L; RAB7L1 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001135664, the custom clone sequence may differ by one or more nucleotides
ATGACACGATTGTATTATCGGGATGCCTCTGCCTGTGTTATTATGTTTGACGTTACCAAT GCCACTACCTTCAGCAACAGCCAGAGGTGGAAACAGGACCTAGACAGCAAGCTCACACTA CCCAATGGAGAGCCGGTGCCCTGCCTGCTCTTGGCCAACAAGTGTGATCTGTCCCCTTGG GCAGTGAGCCGGGACCAGATTGACCGGTTCAGTAAAGAGAACGGTTTCACAGGTTGGACA GAAACATCAGTCAAGGAGAACAAAAATATTAATGAGGCTATGAGAGTCCTCATTGAAAAG ATGATGAGAAATTCCACAGAAGATATCATGTCTTTGTCCACCCAAGGGGACTACATCAAT CTACAAACCAAGTCCTCCAGCTGGTCCTGCTGC |
Restriction Sites | Please inquire |
ACCN | NM_001135664 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001135664.1, NP_001129136.1 |
RefSeq Size | 3070 bp |
RefSeq ORF | 396 bp |
Locus ID | 8934 |
UniProt ID | O14966 |
Protein Families | Druggable Genome |
Gene Summary | Rab GTPase key regulator in vesicle trafficking. Essential for maintaining the integrity of the endosome-trans-Golgi network structure. Together with LRRK2, plays a role in the retrograde trafficking pathway for recycling proteins, such as mannose 6 phosphate receptor (M6PR), between lysosomes and the Golgi apparatus in a retromer-dependent manner. Regulates neuronal process morphology in the intact central nervous system (CNS). May play a role in the formation of typhoid toxin transport intermediates during Salmonella enterica serovar Typhi (S.Typhi) epithelial cell infection.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (4) lacks an internal exon, which results in a downstream AUG start codon, as compared to variant 1. The resulting isoform (4) has a shorter N-terminus, as compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC227110 | RAB7L1 (Myc-DDK-tagged)-Human RAB7, member RAS oncogene family-like 1 (RAB7L1), transcript variant 4 |
CNY 3,990.00 |
|
RC227110L3 | Lenti-ORF clone of RAB7L1 (Myc-DDK-tagged)-Human RAB7, member RAS oncogene family-like 1 (RAB7L1), transcript variant 4 |
CNY 5,890.00 |
|
RC227110L4 | Lenti-ORF clone of RAB7L1 (mGFP-tagged)-Human RAB7, member RAS oncogene family-like 1 (RAB7L1), transcript variant 4 |
CNY 5,890.00 |
|
RG227110 | RAB7L1 (tGFP-tagged) - Human RAB7, member RAS oncogene family-like 1 (RAB7L1), transcript variant 4 |
CNY 4,370.00 |