United States
Germany
Japan
United Kingdom
China
P311 (NREP) (NM_001142479) Human Untagged Clone
CAT＃: SC324695
NREP (untagged)-Human chromosome 5 open reading frame 13 (C5orf13), transcript variant 7
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | C5orf13; D4S114; P311; PRO1873; PTZ17; SEZ17 |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_001142479, the custom clone sequence may differ by one or more nucleotides
ATGGTTTATTACCCAGAACTCTTTGTCTGGGTCAGTCAAGAACCATTTCCAAACAAGGAC ATGGAGGGAAGGCTTCCTAAGGGAAGACTTCCTGTCCCAAAGGAAGTGAACCGCAAGAAG AACGATGAGACAAACGCTGCCTCCCTGACTCCACTGGGCAGCAGTGAACTCCGCTCCCCA AGAATCAGTTACCTCCACTTTTTT |
| Restriction Sites | Please inquire |
| ACCN | NM_001142479 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001142479.1, NP_001135951.1 |
| RefSeq Size | 2105 bp |
| RefSeq ORF | 207 bp |
| Locus ID | 9315 |
| UniProt ID | Q16612 |
| Gene Summary | May have roles in neural function. Ectopic expression augments motility of gliomas. Promotes also axonal regeneration (By similarity). May also have functions in cellular differentiation (By similarity). Induces differentiation of fibroblast into myofibroblast and myofibroblast ameboid migration. Increases retinoic-acid regulation of lipid-droplet biogenesis (By similarity). Down-regulates the expression of TGFB1 and TGFB2 but not of TGFB3 (By similarity). May play a role in the regulation of alveolar generation.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (7) differs in the 5' UTR, compared to variant 1. Variants 1, 4, 5, 6, 7, 8, 9, 10, and 11 encode the same isoform. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC227842 | NREP (Myc-DDK-tagged)-Human chromosome 5 open reading frame 13 (C5orf13), transcript variant 7 |
CNY 1,200.00 |
|
| RC227842L3 | Lenti-ORF clone of NREP (Myc-DDK-tagged)-Human chromosome 5 open reading frame 13 (C5orf13), transcript variant 7 |
CNY 5,890.00 |
|
| RC227842L4 | Lenti-ORF clone of NREP (mGFP-tagged)-Human chromosome 5 open reading frame 13 (C5orf13), transcript variant 7 |
CNY 5,890.00 |
|
| RG227842 | NREP (tGFP-tagged) - Human chromosome 5 open reading frame 13 (C5orf13), transcript variant 7 |
CNY 4,370.00 |
