Glutathione Peroxidase 2 (GPX2) (NM_002083) Human Untagged Clone

Specifications

Product Data
Type	Human Untagged Clone
Synonyms	GI-GPx; GPRP; GPRP-2; GPx-2; GPx-GI; GSHPx-2; GSHPX-GI
Vector	pCMV6-AC
E. coli Selection	Ampicillin (100 ug/mL)
Mammalian Cell Selection	Neomycin
Sequence Data	Fully Sequenced ORF (showhide) >OriGene sequence for NM_002083.2 GGGGGCTCACTCTGCGCTTCACCATGGCTTTCATTGCCAAGTCCTTCTATGACCTCAGTG CCATCAGCCTGGATGGGGAGAAGGTAGATTTCAATACGTTCCGGGGCAGGGCCGTGCTGA TTGAGAATGTGGCTTCGCTCTGAGGCACAACCACCCGGGACTTCACCCAGCTCAACGAGC TGCAATGCCGCTTTCCCAGGCGCCTGGTGGTCCTTGGCTTCCCTTGCAACCAATTTGGAC ATCAGGAGAACTGTCAGAATGAGGAGATCCTGAACAGTCTCAAGTATGTCCGTCCTGGGG GTGGATACCAGCCCACCTTCACCCTTGTCCAAAAATGTGAGGTGAATGGGCAGAACGAGC ATCCTGTCTTCGCCTACCTGAAGGACAAGCTCCCCTACCCTTATGATGACCCATTTTCCC TCATGACCGATCCCAAGCTCATCATTTGGAGCCCTGTGCGCCGCTCAGATGTGGCCTGGA ACTTTGAGAAGTTCCTCATAGGGCCGGAGGGAGAGCCCTTCCGACGCTACAGCCGCACCT TCCCAACCATCAACATTGAGCCTGACATCAAGCGCCTCCTTAAAGTTGCCATATAGATGT GAACTGCTCAACACACAGATCTCCTACTCCATCCAGTCCTGAGGAGCCTTAGGATGCAGC ATGCCTTCAGGAGACACTGCTGGACCTCAGCATTCCCTTGATATCAGTCCCCTTCACTGC AGAGCCTTGCCTTTCCCCTCTGCCTGTTTCCTTTTCCTCTCCCAACCCTCTGGTTGGTGA TTCAACTTGGGCTCCAAGACTTGGGTAAGCTCTGGGCCTTCACAGAATGATGGCACCTTC CTAAACCCTCATGGGTGGTGTCTGAGAGGCGTGAAGGGCCTGGAGCCACTCTGCTAGAAG AGACCAATAAAGGGCAGGTGTGGAAACGGCCAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAACCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites	Please inquire
ACCN	NM_002083
OTI Disclaimer	Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). The expression of this clone is not guaranteed due to the nature of selenoproteins.
OTI Annotation	This clone encodes a selenoprotein containing the rare amino acid selenocysteine (Sec). Sec is encoded by UGA codon, which normally signals translational termination. Expression of this clone is not guaranteed due to the nature of selenoproteins.
Product Components	The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution	1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note	Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq	NM_002083.2, NP_002074.2
RefSeq Size	1024 bp
Locus ID	2877
UniProt ID	P18283
Protein Families	Druggable Genome
Protein Pathways	Arachidonic acid metabolism, Glutathione metabolism
Gene Summary	The protein encoded by this gene belongs to the glutathione peroxidase family, members of which catalyze the reduction of organic hydroperoxides and hydrogen peroxide (H2O2) by glutathione, and thereby protect cells against oxidative damage. Several isozymes of this gene family exist in vertebrates, which vary in cellular location and substrate specificity. This isozyme is predominantly expressed in the gastrointestinal tract (also in liver in human), is localized in the cytoplasm, and whose preferred substrate is hydrogen peroxide. Overexpression of this gene is associated with increased differentiation and proliferation in colorectal cancer. This isozyme is also a selenoprotein, containing the rare amino acid selenocysteine (Sec) at its active site. Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2016] Transcript Variant: This variant (1) represents the protein-coding transcript.

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.