United States
Germany
Japan
United Kingdom
China
PNPLA4 (NM_004650) Human Untagged Clone
CAT＃: SC324530
PNPLA4 (untagged)-Human patatin-like phospholipase domain containing 4 (PNPLA4), transcript variant 1
CNY 2,400.00
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | DXS1283E; GS2; iPLA2eta |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_004650.1
GGCCGGGTGCGGTACCAACCCCTGCCGCAGGACTTTCCTGGGCCGGCTCGCGGAGAGCGT
AGCGCGGCCTTGGTGGCGGAATGGCGTTGAGTGACGGCCCGGCCCCGCCATCTGGTTAAA GGGACTCGTTCAACACGGAAGTGTCCCGGGGCTGCATTGTGCTACAGCTAGAATGAAGCA CATCAACCTATCATTTGCAGCGTGTGGATTTCTGGGCATTTACCACTTGGGGGCAGCATC TGCACTTTGCAGACATGGCAAAAAACTTGTGAAGGATGTCAAAGCCTTCGCTGGGGCGTC TGCGGGATCGTTGGGTGCTTCTGTTCTGCTAACAGCACCAGAAAAAATAGAGGAATGTAA CCAATTTACCTACAAGTTTGCCGAAGAAATCAGAAGGCAGTCTTTCGGGGCAGTAACGCC CGGTTATGACTTCATGGCCCGACTAAGAAGTGGGATGGAGTCGATTCTTCCTCCCAGCGC TCACGAGCTGGCCCAGAACCGACTGCACGTATCCATCACCAACGCCAAAACCAGAGAAAA TCACTTAGTCTCCACTTTTTCCTCCAGGGAGGGCCTCATTAAGGTCCTCCTAGCCAGCAG TTTTGTGCCCATTTATGCAGGACTGAAGCTAGTGGAATACAAAGGGCAGAAGTGGGTGGA CGGAGGCCTCACCAACGCTCTTCCCATCCTGCCCGTCGGCCGGACAGTAACCATCTCCCC CTTCAGTGGACGACTGGACATCTCCCCGCAGGACAAAGGGCAGCTAGATCTGTATGTTAA TATCGCCAAGCAGGATATCATGTTGTCCCTGGCAAACCTGGTGAGACTCAACCAAGCCCT TTTTCCCCCAAGCAAGAGGAAAATGGAATCTTTGTATCAGTGTGGTTTTGATGACACTGT TAAGTTTTTACTTAAAGAAAATTGGTTTGAATAAAATGCATAAAAGTTTATAATGCAGAA AAAAAAAAAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_004650 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_004650.1, NP_004641.1 |
| RefSeq Size | 2809 bp |
| RefSeq ORF | 762 bp |
| Locus ID | 8228 |
| UniProt ID | P41247 |
| Protein Pathways | Retinol metabolism |
| Gene Summary | This gene encodes a member of the patatin-like family of phospholipases. The encoded enzyme has both triacylglycerol lipase and transacylase activities and may be involved in adipocyte triglyceride homeostasis. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome Y. [provided by RefSeq, Feb 2010] Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (1). Variants 1 and 2 encode the same isoform (1). Sequence Note: The RefSeq transcript and protein were derived from transcript and genomic sequence to make the sequence consistent with the reference genome assembly. The extent of this transcript is supported by transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC204732 | PNPLA4 (Myc-DDK-tagged)-Human patatin-like phospholipase domain containing 4 (PNPLA4), transcript variant 1 |
CNY 2,400.00 |
|
| RC204732L3 | Lenti ORF clone of Human patatin-like phospholipase domain containing 4 (PNPLA4), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC204732L4 | Lenti ORF clone of Human patatin-like phospholipase domain containing 4 (PNPLA4), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
| RG204732 | PNPLA4 (tGFP-tagged) - Human patatin-like phospholipase domain containing 4 (PNPLA4), transcript variant 1 |
CNY 4,000.00 |
|
| SC121700 | PNPLA4 (untagged)-Human patatin-like phospholipase domain containing 4 (PNPLA4), transcript variant 1 |
CNY 2,400.00 |
