Arginase 1 (ARG1) (NM_000045) Human Untagged Clone
CAT#: SC324527
ARG1 (untagged)-Human arginase, liver (ARG1)
CNY 2,400.00
CNY 2,950.00
Cited in 1 publication. |
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_000045.2
AGAGCATGAGCGCCAAGTCCAGAACCATAGGGATTATTGGAGCTCCTTTCTCAAAGGGAC
AGCCACGAGGAGGGGTGGAAGAAGGCCCTACAGTATTGAGAAAGGCTGGTCTGCTTGAGA AACTTAAAGAACAAGAGTGTGATGTGAAGGATTATGGGGACCTGCCCTTTGCTGACATCC CTAATGACAGTCCCTTTCAAATTGTGAAGAATCCAAGGTCTGTGGGAAAAGCAAGCGAGC AGCTGGCTGGCAAGGTGGCAGAAGTCAAGAAGAACGGAAGAATCAGCCTGGTGCTGGGCG GAGACCACAGTTTGGCAATTGGAAGCATCTCTGGCCATGCCAGGGTCCACCCTGATCTTG GAGTCATCTGGGTGGATGCTCACACTGATATCAACACTCCACTGACAACCACAAGTGGAA ACTTGCATGGACAACCTGTATCTTTCCTCCTGAAGGAACTAAAAGGAAAGATTCCCGATG TGCCAGGATTCTCCTGGGTGACTCCCTGTATATCTGCCAAGGATATTGTGTATATTGGCT TGAGAGACGTGGACCCTGGGGAACACTACATTTTGAAAACTCTAGGCATTAAATACTTTT CAATGACTGAAGTGGACAGACTAGGAATTGGCAAGGTGATGGAAGAAACACTCAGCTATC TACTAGGAAGAAAGAAAAGGCCAATTCATCTAAGTTTTGATGTTGACGGACTGGACCCAT CTTTCACACCAGCTACTGGCACACCAGTCGTGGGAGGTCTGACATACAGAGAAGGTCTCT ACATCACAGAAGAAATCTACAAAACAGGGCTACTCTCAGGATTAGATATAATGGAAGTGA ACCCATCCCTGGGGAAGACACCAGAAGAAGTAACTCGAACAGTGAACACAGCAGTTGCAA TAACCTTGGCTTGTTTCGGACTTGCTCGGGAGGGTAATCACAAGCCTATTGACTACCTTA ACCCACCTAAGTAAATGTGGAAACATCCGATATAAATCTCATAGTTAATGGCATAATTAG AAAGCTAATCATTTTCTTAAGCATAGAGTTATCCTTCTAAAGACTTGTTCTTTCAGAAAA ATGTTTTTCCAATTAGTATAAACTCTACAAATTCCCTCTTGGTGTAAAATTCAAGATGTG GAAATTCTAACTTTTTTGAAATTTAAAAGCTTATATTTTCTAACTTGGCAAAAGACTTAT CCTTAGAAAGAGAAGTGTACATTGATTTCCAATTAAAAATTTGCTGGCATTAAAAATAAG CACACTTACATAAGCCCCCATACATAGAGTGGGACTCTTGGAATCAGGAGACAAAGCTAC CACATGTGGAAAGGTACTATGTGTCCATGTCATTCAAAAAATGTGATTTTTTATAATAAA CTCTTTATAACAAGACTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_000045 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_000045.2, NP_000036.2 |
RefSeq Size | 1447 bp |
RefSeq ORF | 969 bp |
Locus ID | 383 |
UniProt ID | P05089 |
Domains | arginase |
Protein Families | Druggable Genome |
Protein Pathways | Arginine and proline metabolism, Metabolic pathways |
Gene Summary | Arginase catalyzes the hydrolysis of arginine to ornithine and urea. At least two isoforms of mammalian arginase exist (types I and II) which differ in their tissue distribution, subcellular localization, immunologic crossreactivity and physiologic function. The type I isoform encoded by this gene, is a cytosolic enzyme and expressed predominantly in the liver as a component of the urea cycle. Inherited deficiency of this enzyme results in argininemia, an autosomal recessive disorder characterized by hyperammonemia. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011] Transcript Variant: This variant (2) uses an alternate in-frame splice site at the 5' end of an exon compared to variant 1. The resulting isoform (2) has the same N- and C-termini but is shorter compared to isoform 1. |
Citations (1)
The use of this cDNA Clones has been cited in the following citations: |
---|
TGF-ß Signaling in Myeloid Cells Is Required for Tumor Metastasis
,Yanli Pang, Sudheer Kumar Gara, Bhagelu R. Achyut, Zhaoyang Li, Hannah H. Yan, Chi-Ping Day, Jonathan M. Weiss, Giorgio Trinchieri, John C. Morris, and Li Yang,
Cancer Discovery, Aug 2013; 3: 936 - 951.
,PubMed ID 23661553
[ARG1]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC204649 | ARG1 (Myc-DDK-tagged)-Human arginase, liver (ARG1) |
CNY 3,600.00 |
|
RC204649L1 | Lenti ORF clone of Human arginase, liver (ARG1), Myc-DDK-tagged |
CNY 6,000.00 |
|
RC204649L2 | Lenti ORF clone of Human arginase, liver (ARG1), mGFP tagged |
CNY 5,890.00 |
|
RC204649L3 | Lenti ORF clone of Human arginase, liver (ARG1), Myc-DDK-tagged |
CNY 6,000.00 |
|
RC204649L4 | Lenti ORF clone of Human arginase, liver (ARG1), mGFP tagged |
CNY 6,000.00 |
|
RG204649 | ARG1 (tGFP-tagged) - Human arginase, liver (ARG1) |
CNY 5,200.00 |
|
SC114331 | ARG1 (untagged)-Human arginase, liver (ARG1) |
CNY 2,400.00 |
其它Arginase 1产品