DNase gamma (DNASE1L3) (NM_004944) Human Untagged Clone
CAT#: SC324484
DNASE1L3 (untagged)-Human deoxyribonuclease I-like 3 (DNASE1L3)
CNY 2,400.00
CNY 2,950.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | DHP2; DNAS1L3; LSD; SLEB16 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_004944.2
GGGGAGAATCCAGCACTCCAAGCACTGCTGTCTTCTCACAGAGTCTTGAAGCCAGAGCAG
CACCAGGATGTCACGGGAGCTGGCCCCACTGCTGCTTCTCCTCCTCTCCATCCACAGCGC CCTGGCCATGAGGATCTGCTCCTTCAACGTCAGGTCCTTTGGGGAAAGCAAGCAGGAAGA CAAGAATGCCATGGATGTCATTGTGAAGGTCATCAAACGCTGTGACATCATACTCGTGAT GGAAATCAAGGACAGCAACAACAGGATCTGCCCCATACTGATGGAGAAGCTGAACAGAAA TTCAAGGAGAGGCATAACGTACAACTATGTGATTAGCTCTCGGCTTGGAAGAAACACATA TAAAGAACAATATGCCTTTCTCTACAAGGAAAAGCTGGTGTCTGTGAAGAGGAGTTATCA CTACCATGACTATCAGGATGGAGACGCAGATGTGTTTTCCAGGGAGCCCTTTGTGGTCTG GTTCCAATCTCCCCACACTGCTGTCAAAGACTTCGTGATTATCCCCCTGCACACCACCCC AGAGACATCCGTTAAGGAGATCGATGAGTTGGTTGAGGTCTACACGGACGTGAAACACCG CTGGAAGGCGGAGAATTTCATTTTCATGGGTGACTTCAATGCCGGCTGCAGCTACGTCCC CAAGAAGGCCTGGAAGAACATCCGCTTGAGGACTGACCCCAGGTTTGTTTGGCTGATCGG GGACCAAGAGGACACCACGGTGAAGAAGAGCACCAACTGTGCATATGACAGGATTGTGCT TAGAGGACAAGAAATCGTCAGTTCTGTTGTTCCCAAGTCAAACAGTGTTTTTGACTTCCA GAAAGCTTACAAGCTGACTGAAGAGGAGGCCCTGGATGTCAGCGACCACTTTCCAGTTGA ATTTAAACTACAGTCTTCAAGGGCCTTCACCAACAGCAAAAAATCTGTCACTCTAAGGAA GAAAACAAAGAGCAAACGCTCCTAGACCCAAGGGTCTCATCTTATTAACCATTTCTTGCC TCTAAATAAAATGTCTCTAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_004944 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_004944.2, NP_004935.1 |
RefSeq Size | 1463 bp |
RefSeq ORF | 918 bp |
Locus ID | 1776 |
UniProt ID | Q13609 |
Domains | Exo_endo_phos, DNaseIc |
Protein Families | Druggable Genome |
Gene Summary | This gene encodes a member of the deoxyribonuclease I family. The encoded protein hydrolyzes DNA, is not inhibited by actin, and mediates the breakdown of DNA during apoptosis. Mutations in this gene are a cause of systemic lupus erythematosus-16. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2012] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC205611 | DNASE1L3 (Myc-DDK-tagged)-Human deoxyribonuclease I-like 3 (DNASE1L3) |
CNY 2,400.00 |
|
RC205611L1 | Lenti ORF clone of Human deoxyribonuclease I-like 3 (DNASE1L3), Myc-DDK-tagged |
CNY 4,800.00 |
|
RC205611L2 | Lenti ORF clone of Human deoxyribonuclease I-like 3 (DNASE1L3), mGFP tagged |
CNY 5,890.00 |
|
RC205611L3 | Lenti ORF clone of Human deoxyribonuclease I-like 3 (DNASE1L3), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC205611L4 | Lenti ORF clone of Human deoxyribonuclease I-like 3 (DNASE1L3), mGFP tagged |
CNY 5,890.00 |
|
RG205611 | DNASE1L3 (tGFP-tagged) - Human deoxyribonuclease I-like 3 (DNASE1L3) |
CNY 4,370.00 |
|
SC124096 | DNASE1L3 (untagged)-Human deoxyribonuclease I-like 3 (DNASE1L3) |
CNY 2,400.00 |
其它DNase gamma产品