Peroxiredoxin 3 (PRDX3) (NM_006793) Human Untagged Clone
CAT#: SC324476
PRDX3 (untagged)-Human peroxiredoxin 3 (PRDX3), nuclear gene encoding mitochondrial protein, transcript variant 1
CNY 3,600.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | AOP-1; AOP1; HBC189; MER5; PRO1748; prx-III; SP-22 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_006793.2
GGGGCCCTGCGTCTCTGCCCGCCCCGTGGCGCCCGAGTGCACTGAAGATGGCGGCTGCTG
TAGGACGGTTGCTCCGAGCGTCGGTTGCCCGACATGTGAGTGCCATTCCTTGGGGCATTT CTGCCACTGCAGCCCTCAGGCCTGCTGCATGTGGAAGAACGAGCTTGACAAATTTATTGT GTTCTGGTTCCAGTCAAGCAAAATTATTCAGCACCAGTTCCTCATGCCATGCACCTGCTG TCACCCAGCATGCACCCTATTTTAAGGGTACAGCCGTTGTCAATGGAGAGTTCAAAGACC TAAGCCTTGATGACTTTAAGGGGAAATATTTGGTGCTTTTCTTCTATCCTTTGGATTTCA CCTTTGTGTGTCCTACAGAAATTGTTGCTTTTAGTGACAAAGCTAACGAATTTCACGATG TGAACTGTGAAGTTGTCGCAGTCTCAGTGGATTCCCACTTTAGCCATCTTGCCTGGATAA ATACACCAAGGAAGAATGGTGGTTTGGGCCACATGAACATCGCACTCTTGTCAGACTTAA CTAAGCAGATTTCCCGAGACTACGGTGTGCTGTTAGAAGGTTCTGGTCTTGCACTAAGAG GTCTCTTCATAATTGACCCCAATGGAGTCATCAAGCATTTGAGCGTCAACGATCTCCCAG TGGGCCGAAGCGTGGAAGAAACCCTCCGCTTGGTGAAGGCGTTCCAGTATGTAGAAACAC ATGGAGAAGTCTGCCCAGCGAACTGGACACCGGATTCTCCTACGATCAAGCCAAGTCCAG CTGCTTCCAAAGAGTACTTTCAGAAGGTAAATCAGTAGATCACCCATGTGTATCTGCACC TTCTCAACTGAGAGAAGAACCACAGTTGAAACCTGCTTTTATCATTTTCAAGATGGTTAT TTGTAGAAGGCAAGGAACCAATTATGCTTGTATTCATAAGTATTACTCTAAATGTTTTGT TTTTGTAATTCTGGCTAAGACCTTTTAAACATGGTTAGTTGCTAGTACAAGGAATCCTTT ATTGGTAACATCTTGGTGGCTGGCTAGCTAGTTTCTACAGAACATAATTTGCCTCTATAG AAGGCTATTCTTAGATCATGTCTCAATGGAAACACTCTTCTTTCTTAGCCTTACTTGAAT CTTGCCTATAATAAAGTAGAGCAACACACATTGAAAGCTTCTGATCAACGGTCCTGAAAT TTTCATCTTGAATGTCTTTGTATTAAACTGAATTTTCTTTTAAGCTAACAAAGATCATAA TTTTCCATGATTAGCCGTGTAACTCCTGCAATGAATGTTTATGTGATTGAAGCAAATGTG AATCGTATTATTTTAAAAAGTGGCAGAGTGACTTAACTGATCATGCATGATCCCTCATCC CTGAAATTGAGTTTATGTAGTCATTTTACTTATTTTATTCATTAGCTAACTTTGTCTATG TATATTTCTAGATATTGATTAGTGTAATCGATTATAAAGGATATTTATCAAATCCAGGGA TTGCATTTTGAAATTATAATTATTTTCTTTGCTGAAGTATTCGTTGTAAAACATACAAAA TAAACATATTTTAAAACATTTGCATTTTGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_006793 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_006793.2, NP_006784.1 |
RefSeq Size | 1591 bp |
RefSeq ORF | 771 bp |
Locus ID | 10935 |
UniProt ID | P30048 |
Domains | AhpC-TSA |
Protein Families | Transcription Factors |
Gene Summary | This gene encodes a mitochondrial protein with antioxidant function. The protein is similar to the C22 subunit of Salmonella typhimurium alkylhydroperoxide reductase, and it can rescue bacterial resistance to alkylhydroperoxide in E. coli that lack the C22 subunit. The human and mouse genes are highly conserved, and they map to the regions syntenic between mouse and human chromosomes. Sequence comparisons with recently cloned mammalian homologs suggest that these genes consist of a family that is responsible for the regulation of cellular proliferation, differentiation and antioxidant functions. This family member can protect cells from oxidative stress, and it can promote cell survival in prostate cancer. Alternative splicing of this gene results in multiple transcript variants. Related pseudogenes have been identified on chromosomes 1, 3, 13 and 22. [provided by RefSeq, Oct 2014] Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (a). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC205080 | PRDX3 (Myc-DDK-tagged)-Human peroxiredoxin 3 (PRDX3), nuclear gene encoding mitochondrial protein, transcript variant 1 |
CNY 3,600.00 |
|
RC205080L1 | Lenti ORF clone of Human peroxiredoxin 3 (PRDX3), nuclear gene encoding mitochondrial protein, transcript variant 1, Myc-DDK-tagged |
CNY 6,000.00 |
|
RC205080L2 | Lenti ORF clone of Human peroxiredoxin 3 (PRDX3), nuclear gene encoding mitochondrial protein, transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RC205080L3 | Lenti ORF clone of Human peroxiredoxin 3 (PRDX3), nuclear gene encoding mitochondrial protein, transcript variant 1, Myc-DDK-tagged |
CNY 6,000.00 |
|
RC205080L4 | Lenti ORF clone of Human peroxiredoxin 3 (PRDX3), nuclear gene encoding mitochondrial protein, transcript variant 1, mGFP tagged |
CNY 6,000.00 |
|
RG205080 | PRDX3 (tGFP-tagged) - Human peroxiredoxin 3 (PRDX3), nuclear gene encoding mitochondrial protein, transcript variant 1 |
CNY 5,200.00 |
|
SC115851 | PRDX3 (untagged)-Human peroxiredoxin 3 (PRDX3), nuclear gene encoding mitochondrial protein, transcript variant 1 |
CNY 3,600.00 |
其它Peroxiredoxin 3产品