RAB3C (NM_138453) Human Untagged Clone
CAT#: SC324437
RAB3C (untagged)-Human RAB3C, member RAS oncogene family (RAB3C)
CNY 2,400.00
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_138453.2
TGCAGAGTGTGGAGCGTGGAGCGCCGGGACTGTGCACGCTTGACCGGAAGCCCAGACCAG
TGCGGTCCTAGCCAGAGAGAAAGGACATTTGCCAACAATGAGACACGAAGCGCCCATGCA GATGGCCTCTGCCCAAGATGCCAGGTACGGCCAGAAAGACTCCTCTGATCAGAACTTTGA CTACATGTTCAAATTACTCATCATCGGCAATAGCAGTGTGGGGAAAACATCTTTTCTATT CCGTTATGCAGATGACTCCTTTACATCTGCATTCGTCAGCACAGTTGGGATCGATTTCAA AGTAAAAACTGTATTCAAAAATGAAAAGAGAATCAAGCTTCAGATTTGGGACACAGCAGG CCAGGAAAGATACAGGACTATCACCACAGCCTATTATCGTGGAGCCATGGGCTTTATTTT AATGTATGACATTACAAATGAAGAATCCTTCAATGCAGTACAAGATTGGTCAACTCAAAT CAAAACATACTCTTGGGACAATGCCCAAGTTATTCTGGTTGGGAACAAGTGTGACATGGA AGACGAGCGGGTCATCTCAACTGAGCGAGGTCAACATTTAGGAGAACAGCTTGGGTTTGA GTTTTTTGAAACAAGTGCCAAGGACAACATTAATGTCAAGCAGACATTTGAGCGCCTTGT GGATATCATCTGCGACAAAATGTCAGAGAGTTTGGAGACTGATCCTGCCATCACTGCTGC AAAGCAGAACACGAGACTCAAGGAAACTCCTCCTCCACCGCAGCCCAACTGTGCCTGCTA GTGTCCCCGTGCACACAGGCAGCTCCAGGGGGCTCTGGTTGCCAACAAACAGCATTTGTA AATGGTCTATTAGCCTTCATTTATACTGCCTAACAATTATTTGAAGGAATAAATTGATGT CAATGGCTCGTACGCATTCAATTCTTGGGAGCTTTCCTGTTTAATATGTGGCAAATATGT GATCTTAAATTTATAAGGACTATCCATCTATAAACATCTGGTACCTGCAAAAAAAAAAAA AAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_138453 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_138453.2, NP_612462.1 |
RefSeq Size | 1030 bp |
RefSeq ORF | 684 bp |
Locus ID | 115827 |
UniProt ID | Q96E17 |
Domains | ras, RAN, RAS, RHO, RAB |
Protein Families | Druggable Genome |
Gene Summary | This gene is a member of the RAS oncogene family and encodes a small GTPase. Other similar small GTPases are known to be involved in vesicle trafficking, and the encoded protein was shown to play a role in recycling phagocytosed MHC class 1 complexes to the cell surface. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2015] Transcript Variant: This variant (1) encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC201436 | RAB3C (Myc-DDK-tagged)-Human RAB3C, member RAS oncogene family (RAB3C) |
CNY 2,400.00 |
|
RC201436L3 | Lenti ORF clone of Human RAB3C, member RAS oncogene family (RAB3C), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC201436L4 | Lenti ORF clone of Human RAB3C, member RAS oncogene family (RAB3C), mGFP tagged |
CNY 5,890.00 |
|
RG201436 | RAB3C (tGFP-tagged) - Human RAB3C, member RAS oncogene family (RAB3C) |
CNY 4,000.00 |
|
SC120463 | RAB3C (untagged)-Human RAB3C, member RAS oncogene family (RAB3C) |
CNY 3,990.00 |