United States
Germany
Japan
United Kingdom
China
PSME1 (NM_006263) Human Untagged Clone
CAT＃: SC324397
PSME1 (untagged)-Human proteasome (prosome, macropain) activator subunit 1 (PA28 alpha) (PSME1), transcript variant 1
CNY 2,400.00
CNY 2,950.00
Product images
热销推荐Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | HEL-S-129m; IFI5111; PA28A; PA28alpha; REGalpha |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_006263.2
CGGAGCTGGGTGCGAGCGCCCTACCGCTTTCGCTTTCCCTTCGCGGTGCCCACTCCACTC
CTTGTGCGGCGCTAGGCCCCCCGTCCCGGTCATGGCCATGCTCAGGGTCCAGCCCGAGGC CCAAGCCAAGGTGGATGTGTTTCGTGAAGACCTCTGTACCAAGACAGAGAACCTGCTCGG GAGCTATTTCCCCAAGAAGATTTCTGAGCTGGATGCATTTTTAAAGGAGCCAGCTCTCAA TGAAGCCAACTTGAGCAATCTGAAGGCCCCATTGGACATCCCAGTGCCTGATCCAGTCAA GGAGAAAGAGAAAGAGGAGCGGAAGAAACAGCAGGAGAAGGAAGACAAGGATGAAAAGAA GAAGGGGGAGGATGAAGACAAAGGTCCTCCCTGTGGCCCAGTGAACTGCAATGAAAAGAT CGTGGTCCTTCTGCAGCGCTTGAAGCCTGAGATCAAGGATGTCATTGAGCAGCTCAACCT GGTCACCACCTGGTTGCAGCTGCAGATACCTCGGATTGAGGATGGTAACAATTTTGGAGT GGCTGTCCAGGAGAAGGTGTTTGAGCTGATGACCAGCCTCCACACCAAGCTAGAAGGCTT CCACACTCAAATCTCTAAGTATTTCTCTGAGCGTGGTGATGCAGTGACTAAAGCAGCCAA GCAGCCCCATGTGGGTGATTATCGGCAGCTGGTGCACGAGCTGGATGAGGCAGAGTACCG GGACATCCGGCTGATGGTCATGGAGATCCGCAATGCTTATGCTGTGTTATATGACATCAT CCTGAAGAACTTCGAGAAGCTCAAGAAGCCCAGGGGAGAAACAAAGGGAATGATCTATTG AGAGCCCTCTCTCCCATTCTGTGATGAGTACAGCAGAGACCTTCCTGCTTTTTACTGGGG ACTCCAGATTTTCCCCAAACTTGCTTCTGTTGAGATTTTTCCCTCACCTTGCCTCTCAGG CACAATAAATATAGTTATACCACTGCCCAAAAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_006263 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_006263.2, NP_006254.1 |
| RefSeq Size | 1012 bp |
| RefSeq ORF | 750 bp |
| Locus ID | 5720 |
| UniProt ID | Q06323 |
| Domains | PA28_alpha, PA28_beta |
| Protein Pathways | Antigen processing and presentation, Proteasome |
| Gene Summary | The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. The immunoproteasome contains an alternate regulator, referred to as the 11S regulator or PA28, that replaces the 19S regulator. Three subunits (alpha, beta and gamma) of the 11S regulator have been identified. This gene encodes the alpha subunit of the 11S regulator, one of the two 11S subunits that is induced by gamma-interferon. Three alpha and three beta subunits combine to form a heterohexameric ring. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013] Transcript Variant: This variant (1) encodes isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC201260 | PSME1 (Myc-DDK-tagged)-Human proteasome (prosome, macropain) activator subunit 1 (PA28 alpha) (PSME1), transcript variant 1 |
CNY 2,400.00 |
|
| RC201260L1 | Lenti ORF clone of Human proteasome (prosome, macropain) activator subunit 1 (PA28 alpha) (PSME1), transcript variant 1, Myc-DDK-tagged |
CNY 4,800.00 |
|
| RC201260L2 | Lenti ORF clone of Human proteasome (prosome, macropain) activator subunit 1 (PA28 alpha) (PSME1), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
| RC201260L3 | Lenti ORF clone of Human proteasome (prosome, macropain) activator subunit 1 (PA28 alpha) (PSME1), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC201260L4 | Lenti ORF clone of Human proteasome (prosome, macropain) activator subunit 1 (PA28 alpha) (PSME1), transcript variant 1, mGFP tagged |
CNY 4,800.00 |
|
| RG201260 | PSME1 (tGFP-tagged) - Human proteasome (prosome, macropain) activator subunit 1 (PA28 alpha) (PSME1), transcript variant 1 |
CNY 4,000.00 |
|
| SC111680 | PSME1 (untagged)-Human proteasome (prosome, macropain) activator subunit 1 (PA28 alpha) (PSME1), transcript variant 1 |
CNY 2,400.00 |
