HEXIM2 (NM_144608) Human Untagged Clone
CAT#: SC324352
HEXIM2 (untagged)-Human hexamthylene bis-acetamide inducible 2 (HEXIM2)
CNY 2,400.00
CNY 6,270.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | L3 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_144608.1
GAATAAGGGTGTCACTAGTTCCAGGCGTCTGCTGAAAGATTTGGAACAGAAGATGATGGC
CACTCCGAACCAGACCGCCTGTAATGCAGAGTCACCAGTGGCCCTGGAGGAGGCCAAGAC CTCTGGTGCCCCGGGGAGCCCCCAAACACCCCCTGAGCGTCATGACTCTGGTGGTTCCCT GCCCCTGACACCGCGGATGGAGAGCCACTCAGAGGATGAAGATCTTGCTGGGGCTGTCGG TGGCCTGGGCTGGAACAGTAGGAGTCCCCGGACCCAGAGCCCAGGGGGCTGCTCAGCGGA GGCTGTGCTGGCCCGGAAGAAACACCGTCGGCGGCCATCGAAGCGCAAAAGGCACTGGCG ACCCTACCTGGAGCTGAGCTGGGCTGAGAAACAACAGCGGGATGAGAGGCAGAGCCAGAG GGCCTCCCGGGTCCGCGAAGAGATGTTCGCCAAAGGCCAGCCCGTGGCCCCCTACAACAC CACCCAGTTCCTGATGAATGACAGGGACCCGGAGGAGCCCAACTTGGATGTGCCCCATGG GATCTCCCACCCAGGTTCCAGTGGGGAGAGTGAGGCCGGGGACAGTGATGGGCGGGGCCG AGCGCACGGTGAGTTCCAGCGGAAGGACTTCTCTGAGACTTACGAACGCTTCCACACCGA GAGCCTGCAGGGCCGCAGCAAGCAGGAGCTGGTGCGAGACTACCTGGAGCTGGAGAAGCG GCTGTCGCAGGCGGAGGAGGAGACTAGGAGGCTGCAGCAGCTGCAGGCGTGCACCGGCCA GCAGTCCTGCCGCCAGGTGGAGGAGCTGGCTGCCGAGGTCCAGAGGCTCCGGACCGAAAA CCAGCGGCTTCGTCAGGAGAACCAGATGTGGAACCGAGAGGGCTGCCGCTGTGATGAGGA GCCGGGTACCTAGGGGTGCCTCCCAGCCTGGTGGACCCAAGGAGAAGGTCCCATTTCGTG CACACTCAGGCCAGCTGGGTCTCAAGGAGGCAGGTGGCAGATGAAAACCACCGTCAACAC CCTGTGCGCCCTGAGAACAGCTAAATCGGTTCAGACTCCCACCTCACCGTTTCCATAGTT GGCTCTTTTGTGTCATCTTACCCTTTACAGAGAAATTAAATGGCCTTGGTGGGACCAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_144608 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_144608.1, NP_653209.1 |
RefSeq Size | 1330 bp |
RefSeq ORF | 861 bp |
Locus ID | 124790 |
UniProt ID | Q96MH2 |
Protein Families | Transcription Factors |
Gene Summary | This gene encodes a member of the HEXIM family of proteins. This protein is a component of the 7SK small nuclear ribonucleoprotein. This protein has been found to negatively regulate the kinase activity of the cyclin-dependent kinase P-TEFb, which phosphorylates multiple target proteins to promote transcriptional elongation. This gene is located approximately 7 kb downstream from related family member HEXIM1 on chromosome 17. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1-9 encode the same isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC204552 | HEXIM2 (Myc-DDK-tagged)-Human hexamthylene bis-acetamide inducible 2 (HEXIM2) |
CNY 2,400.00 |
|
RC204552L1 | Lenti ORF clone of Human hexamthylene bis-acetamide inducible 2 (HEXIM2), Myc-DDK-tagged |
CNY 4,800.00 |
|
RC204552L2 | Lenti ORF clone of Human hexamthylene bis-acetamide inducible 2 (HEXIM2), mGFP tagged |
CNY 5,890.00 |
|
RC204552L3 | Lenti ORF clone of Human hexamthylene bis-acetamide inducible 2 (HEXIM2), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC204552L4 | Lenti ORF clone of Human hexamthylene bis-acetamide inducible 2 (HEXIM2), mGFP tagged |
CNY 5,890.00 |
|
RG204552 | HEXIM2 (tGFP-tagged) - Human hexamthylene bis-acetamide inducible 2 (HEXIM2) |
CNY 4,000.00 |
|
SC120749 | HEXIM2 (untagged)-Human hexamthylene bis-acetamide inducible 2 (HEXIM2) |
CNY 6,270.00 |