Calcyon (CALY) (NM_015722) Human Untagged Clone
CAT#: SC324200
CALY (untagged)-Human calcyon neuron-specific vesicular protein (CALY)
CNY 2,400.00
CNY 2,950.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | DRD1IP; NSG3 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_015722.2
CCCGACCGCGTCCTGCAGCAGCTGCCAGTGGAGCCGCCTGACAAGGACTGCCATCCACCA
TGGTGAAGCTGGGCTGCAGCTTCTCTGGGAAGCCAGGTAAAGACCCTGGGGACCAGGATG GGGCTGCCATGGACAGTGTGCCTCTGATCAGCCCCTTGGACATCAGCCAGCTCCAGCCGC CACTCCCTGACCAGGTGGTCATCAAGACACAGACAGAATACCAGCTGTCCTCCCCAGACC AGCAGAATTTCCCTGACCTGGAGGGCCAGAGGCTGAACTGCAGCCACCCAGAGGAAGGGC GCAGGCTGCCCACCGCACGGATGATCGCCTTCGCCATGGCGCTACTGGGCTGCGTGCTGA TCATGTACAAGGCCATCTGGTACGACCAGTTCACCTGCCCCGACGGCTTCCTGCTGCGGC ACAAGATCTGCACGCCGCTGACCCTGGAGATGTACTACACGGAGATGGACCCCGAGCGCC ACCGCAGCATCCTGGCGGCCATCGGGGCCTACCCGCTGAGCCGCAAGCACGGCACGGAGA CGCCGGCGGCCTGGGGGGACGGCTACCGCGCAGCCAAGGAGGAGCGCAAGGGGCCCACCC AGGCTGGGGCGGCGGCGGCGGCCACCGAACCCCCCGGGAAGCCGTCGGCCAAGGCGGAGA AGGAGGCGGCGCGGAAGGCGGCCGGGAGCGCGGCGCCCCCGCCCGCGCAGTGACGTCTCC AGCCCCGCAGCCCGGCCCGGGCGTCCTCCGCCAGCTCCTGTGACCAGCGCGTCTCCCGAT GCTCTCCGCCGTGTTCGTGTCCCCAGGCGCCCTCGCTGCAGCCCCGCCCCCGTGGGTCTC TGACTCTGTCGCTTTTCTCTAAGTAAAGATTTCACGTCCAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | ECoRI-NOT |
ACCN | NM_015722 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_015722.2, NP_056537.1 |
RefSeq Size | 915 bp |
RefSeq ORF | 654 bp |
Locus ID | 50632 |
UniProt ID | Q9NYX4 |
Protein Families | Druggable Genome, Transmembrane |
Gene Summary | The protein encoded by this gene is a type II single transmembrane protein. It is required for maximal stimulated calcium release after stimulation of purinergic or muscarinic but not beta-adrenergic receptors. The encoded protein interacts with D1 dopamine receptor and may interact with other DA receptor subtypes and/or GPCRs. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC207894 | CALY (Myc-DDK-tagged)-Human calcyon neuron-specific vesicular protein (CALY) |
CNY 2,400.00 |
|
RC207894L3 | Lenti ORF clone of Human calcyon neuron-specific vesicular protein (CALY), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC207894L4 | Lenti ORF clone of Human calcyon neuron-specific vesicular protein (CALY), mGFP tagged |
CNY 5,890.00 |
|
RG207894 | CALY (tGFP-tagged) - Human calcyon neuron-specific vesicular protein (CALY) |
CNY 4,370.00 |
|
SC114622 | CALY (untagged)-Human calcyon neuron-specific vesicular protein (CALY) |
CNY 2,400.00 |
其它Calcyon产品