WFDC1 (NM_021197) Human Untagged Clone
CAT#: SC323832
WFDC1 (untagged)-Human WAP four-disulfide core domain 1 (WFDC1)
CNY 2,400.00
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | PS20 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_021197.2
CACTCACAGGCCCACGCAGCGAGGGGGGCCCCTCTTCTGTGTGCGTCTGGAAGGTCGCTG
CCCAGGGAGGAAATGCCTTTAACCGGCGTGGGGCCGGGCAGCTGCAGGAGGCAGATCATC CGGGCTCTGTGCCTCTTGCTACTTCTCCTCCACGCCGGCTCTGCCAAGAATATCTGGAAA CGGGCATTGCCTGCGAGGCTGGCCGAGAAATCCCGTGCCGAGGAGGCGGGCGCGCCCGGC GGCCCCCGGCAGCCCCGAGCAGACCGCTGCCCGCCGCCTCCGCGGACGCTGCCCCCCGGC GCCTGCCAGGCCGCGCGCTGTCAGGCGGACTCCGAGTGCCCGCGGCACCGGCGCTGCTGC TACAACGGATGCGCCTACGCCTGCCTAGAAGCTGTGCCGCCCCCGCCAGTCTTAGACTGG CTGGTGCAGCCGAAACCTCGATGGCTTGGTGGCAATGGCTGGCTCCTGGATGGCCCTGAG GAGGTGTTACAAGCAGAGGCGTGCAGCACCACGGAGGATGGGGCCGAACCCCTGCTCTGT CCCTCGGGCTATGAGTGCCACATCCTGAGCCCAGGTGACGTGGCCGAAGGTATCCCCAAC CGTGGGCAGTGCGTCAAGCAGCGCCGGCAAGCAGATGGGCGAATCCTACGACACAAACTT TACAAAGAATATCCAGAAGGTGACTCAAAGAATGTGGCAGAACCTGGAAGGGGACAACAG AAGCACTTTCAGTAAAGCAACGGCAAGCAGCTAGGTTGCAAGAACATTCCTCTACTTTCT GCTAAGCCTTGGAAACAGTTGGGAAAAGTAGTTTGACCCTCACAGTTCACATTCAGCTCA GCAGAGCAAGACCCCAGAGATGCTTAGAGACAGGACACCTGGCCATCAAACCCAGTTTGG CCCAGCCTGGTTGGGTGACTTTGTGGGAGCCACTTAACAGCTCTGGGTCCCTGTTTTACC ATCCTGGGAGCAAGGCCCTGCAGCTCCACGAGACCTTTACCCCGGGAAGAAGCCGCCGCC CATGAAAGCATTTCTGAAGCCCCTTTCTAAGACAAGGCTCAGCATCTTGATATTTTTGAC AGATTCCTCCCAAGTCTGGCTCTGGGAGGTATGTACCCATCTCAAATGTTCCCAAGATAA ATTCATCCATCAGGAAATGGAAATGAACTTGCTTACTAATGTGTGATTCCTAGTTGTAGC CACCGGATGTGCTGAGGCCTAAATGTTAGCAGGTGGGAGGAGGCCACAGAACAATAAAAA CAACCAAATAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | ECoRI-NOT |
ACCN | NM_021197 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_021197.2, NP_067020.2 |
RefSeq Size | 1396 bp |
RefSeq ORF | 663 bp |
Locus ID | 58189 |
UniProt ID | Q9HC57 |
Domains | WAP |
Protein Families | Secreted Protein |
Gene Summary | This gene encodes a member of the WAP-type four disulfide core domain family. The WAP-type four-disulfide core domain contains eight cysteines forming four disulfide bonds at the core of the protein, and functions as a protease inhibitor in many family members. This gene is mapped to chromosome 16q24, an area of frequent loss of heterozygosity in cancers, including prostate, breast and hepatocellular cancers and Wilms' tumor. This gene is downregulated in many cancer types and may be involved in the inhibition of cell proliferation. The encoded protein may also play a role in the susceptibility of certain CD4 memory T cells to human immunodeficiency virus infection. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013] Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (1). Both variants 1 and 2 encode the same isoform. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC206450 | WFDC1 (Myc-DDK-tagged)-Human WAP four-disulfide core domain 1 (WFDC1) |
CNY 2,400.00 |
|
RC206450L1 | Lenti ORF clone of Human WAP four-disulfide core domain 1 (WFDC1), Myc-DDK-tagged |
CNY 4,800.00 |
|
RC206450L2 | Lenti ORF clone of Human WAP four-disulfide core domain 1 (WFDC1), mGFP tagged |
CNY 5,890.00 |
|
RC206450L3 | Lenti ORF clone of Human WAP four-disulfide core domain 1 (WFDC1), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC206450L4 | Lenti ORF clone of Human WAP four-disulfide core domain 1 (WFDC1), mGFP tagged |
CNY 5,890.00 |
|
RG206450 | WFDC1 (tGFP-tagged) - Human WAP four-disulfide core domain 1 (WFDC1) |
CNY 4,000.00 |
|
SC112956 | WFDC1 (untagged)-Human WAP four-disulfide core domain 1 (WFDC1) |
CNY 2,400.00 |