United States
Germany
Japan
United Kingdom
China
TSPAN6 (NM_003270) Human Untagged Clone
CAT＃: SC323749
TSPAN6 (untagged)-Human tetraspanin 6 (TSPAN6)
CNY 2,400.00
CNY 2,950.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | T245; TM4SF6; TSPAN-6 |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_003270.2
CGCTCGTAAGTTTTCGGCAGTTTCCGGGGAGACTCGGGGACTCCGCGTCTCGCTCTCTGT
GTTCCAATCGCCCGGTGCGGTGGTGCAGGGTCTCGGGCTAGTCATGGCGTCCCCGTCTCG GAGACTGCAGACTAAACCAGTCATTACTTGTTTCAAGAGCGTTCTGCTAATCTACACTTT TATTTTCTGGATCACTGGCGTTATCCTTCTTGCAGTTGGCATTTGGGGCAAGGTGAGCCT GGAGAATTACTTTTCTCTTTTAAATGAGAAGGCCACCAATGTCCCCTTCGTGCTCATTGC TACTGGTACCGTCATTATTCTTTTGGGCACCTTTGGTTGTTTTGCTACCTGCCGAGCTTC TGCATGGATGCTAAAACTGTATGCAATGTTTCTGACTCTCGTTTTTTTGGTCGAACTGGT CGCTGCCATCGTAGGATTTGTTTTCAGACATGAGATTAAGAACAGCTTTAAGAATAATTA TGAAAAGGCTTTGAAGCAGTATAACTCTACAGGAGATTATAGAAGCCATGCAGTAGACAA GATCCAAAATACGTTGCATTGTTGTGGTGTCACCGATTATAGAGATTGGACAGATACTAA TTATTACTCAGAAAAAGGATTTCCTAAGAGTTGCTGTAAACTTGAAGATTGTACTCCACA GAGAGATGCAGACAAAGTAAACAATGAAGGTTGTTTTATAAAGGTGATGACCATTATAGA GTCAGAAATGGGAGTCGTTGCAGGAATTTCCTTTGGAGTTGCTTGCTTCCAACTGATTGG AATCTTTCTCGCCTACTGCCTCTCTCGTGCCATAACAAATAACCAGTATGAGATAGTGTA ACCCAATGTATCTGTGGGCCTATTCCTCTCTACCTTTAAGGACATTTAGGGTCCCCCCTG TGAATTAGAAAGTTGCTTGGCTGGAGAACTGACAACACTACTTACTGATAGACCAAAAAA CTACACCAGTAGGTTGATTCAATCAAGATGTATGTAGACCTAAAACTACACCAATAGGCT GATTCAATCAAGATCCGTGCTCGCAGTGGGCTGATTCAATCAAGATGTATGTTTGCTATG TTCTAAGTCCACCTTCTATCCCATTCATGTTAGATCGTTGAAACCCTGTATCCCTCTGAA ACACTGGAAGAGCTAGTAAATTGTAAATGAAGTAAAAAAAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | ECoRI-NOT |
| ACCN | NM_003270 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_003270.2, NP_003261.1 |
| RefSeq Size | 2069 bp |
| RefSeq ORF | 738 bp |
| Locus ID | 7105 |
| UniProt ID | O43657 |
| Domains | transmembrane4 |
| Protein Families | Transmembrane |
| Gene Summary | The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. The protein encoded by this gene is a cell surface glycoprotein and is highly similar in sequence to the transmembrane 4 superfamily member 2 protein. It functions as a negative regulator of retinoic acid-inducible gene I-like receptor-mediated immune signaling via its interaction with the mitochondrial antiviral signaling-centered signalosome. This gene uses alternative polyadenylation sites, and multiple transcript variants result from alternative splicing. [provided by RefSeq, Jul 2013] Transcript Variant: This variant (1) encodes the longest isoform (a). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC202014 | TSPAN6 (Myc-DDK-tagged)-Human tetraspanin 6 (TSPAN6) |
CNY 2,400.00 |
|
| RC202014L1 | Lenti ORF clone of Human tetraspanin 6 (TSPAN6), Myc-DDK-tagged |
CNY 4,800.00 |
|
| RC202014L2 | Lenti ORF clone of Human tetraspanin 6 (TSPAN6), mGFP tagged |
CNY 5,890.00 |
|
| RC202014L3 | Lenti ORF clone of Human tetraspanin 6 (TSPAN6), Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC202014L4 | Lenti ORF clone of Human tetraspanin 6 (TSPAN6), mGFP tagged |
CNY 5,890.00 |
|
| RG202014 | TSPAN6 (tGFP-tagged) - Human tetraspanin 6 (TSPAN6) |
CNY 4,370.00 |
|
| SC118090 | TSPAN6 (untagged)-Human tetraspanin 6 (TSPAN6) |
CNY 2,400.00 |
