ASAH1 (NM_001127505) Human Untagged Clone

CAT#: SC323014

ASAH1 (untagged)-Human N-acylsphingosine amidohydrolase (acid ceramidase) 1 (ASAH1), transcript variant 3



  "NM_001127505" in other vectors (6)

CNY 6,370.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal ASAH1 Antibody
    • 100 ug

CNY 5,808.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms AC; ACDase; ASAH; PHP; PHP32; SMAPME
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC323014 representing NM_001127505.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAACTGCTGCATCGGGCTGGGAGAGAAAGCTCGCGGGTCCCACCGGGCCTCCTACCCAAGTCTCAGC
GCGCTTTTCACCGAGGCCTCAATTCTGGGATTTGGCAGCTTTGCTGTGAAAGCCCAATGGACAGAGGAC
TGCAGAAAATCAACCTATCCTCCTTCAGGACCAACTGTCTTCCCTGCTGTTATAAGGTACAGAGGTGCA
GTTCCATGGTACACCATAAATCTTGACTTACCACCCTACAAAAGATGGCATGAATTGATGCTTGACAAG
GCACCAGTGCCTGGCCTACTTGGCAACTTTCCTGGCCCTTTTGAAGAGGAAATGAAGGGTATTGCCGCT
GTTACTGATATACCTTTAGGAGAGATTATTTCATTCAATATTTTTTATGAATTATTTACCATTTGTACT
TCAATAGTAGCAGAAGACAAAAAAGGTCATCTAATACATGGGAGAAACATGGATTTTGGAGTATTTCTT
GGGTGGAACATAAATAATGATACCTGGGTCATAACTGAGCAACTAAAACCTTTAACAGTGAATTTGGAT
TTCCAAAGAAACAACAAAACTGTCTTCAAGGCTTCAAGCTTTGCTGGCTATGTGGGCATGTTAACAGGA
TTCAAACCAGGACTGTTCAGTCTTACACTGAATGAACGTTTCAGTATAAATGGTGGTTATCTGGGTATT
CTAGAATGGATTCTGGGAAAGAAAGATGTCATGTGGATAGGGTTCCTCACTAGAACAGTTCTGGAAAAT
AGCACAAGTTATGAAGAAGCCAAGAATTTATTGACCAAGACCAAGATATTGGCCCCAGCCTACTTTATC
CTGGGAGGCAACCAGTCTGGGGAAGGTTGTGTGATTACACGAGACAGAAAGGAATCATTGGATGTATAT
GAACTCGATGCTAAGCAGGGTAGATGGTATGTGGTACAAACAAATTATGACCGTTGGAAACATCCCTTC
TTCCTTGATGATCGCAGAACGCCTGCAAAGATGTGTCTGAACCGCACCAGCCAAGAGAATATCTCATTT
GAAACCATGTATGATGTCCTGTCAACAAAACCTGTCCTCAACAAGCTGACCGTATACACAACCTTGATA
GATGTTACCAAAGGTCAATTCGAAACTTACCTGCGGGACTGCCCTGACCCTTGTATAGGTTGGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001127505
Insert Size 1170 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001127505.2
RefSeq Size 2602 bp
RefSeq ORF 1170 bp
Locus ID 427
UniProt ID Q13510
Protein Families Druggable Genome
Protein Pathways Lysosome, Metabolic pathways, Sphingolipid metabolism
MW 44 kDa
Gene Summary This gene encodes a member of the acid ceramidase family of proteins. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed. Processing of this preproprotein generates alpha and beta subunits that heterodimerize to form the mature lysosomal enzyme, which catalyzes the degradation of ceramide into sphingosine and free fatty acid. This enzyme is overexpressed in multiple human cancers and may play a role in cancer progression. Mutations in this gene are associated with the lysosomal storage disorder, Farber lipogranulomatosis, and a neuromuscular disorder, spinal muscular atrophy with progressive myoclonic epilepsy. [provided by RefSeq, Oct 2015]
Transcript Variant: This variant (3) contains an alternate in-frame exon and lacks another alternate in-frame exon compared to variant 2. The resulting isoform (c) has the same N- and C-termini but is shorter compared to isoform b.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...