United States
Germany
Japan
United Kingdom
China
Haptoglobin (HP) (NM_001126102) Human Untagged Clone
CAT＃: SC322992
HP (untagged)-Human haptoglobin (HP), transcript variant 2
CNY 3,656.00
CNY 7,220.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | BP; HP2ALPHA2; HPA1S |
| Vector | pCMV6-XL4 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_001126102 edited
GACCAACCAAGATGAGTGCCCTGGGAGCTGTCATTGCCCTCCTGCTCTGGGGACAGCTTT TTGCAGTGGACTCAGGCAATGATGTCACGGATATCGCAGATGACGGCTGCCCGAAGCCCC CCGAGATTGCACATGGCTATGTGGAGCACTCGGTTCGCTACCAGTGTAAGAACTACTACA AACTGCGCACAGAAGGAGATGGAGTGTACACCTTAAACAATGAGAAGCAGTGGATAAATA AGGCTGTTGGAGATAAACTTCCTGAATGTGAAGCAGTATGTGGGAAGCCCAAGAATCCGG CAAACCCAGTGCAGCGGATCCTGGGTGGACACCTGGATGCCAAAGGCAGCTTTCCCTGGC AGGCTAAGATGGTTTCCCACCATAATCTCACCACAGGTGCCACGCTGATCAATGAACAAT GGCTGCTGACCACGGCTAAAAATCTCTTCCTGAACCATTCAGAAAATGCAACAGCGAAAG ACATTGCCCCTACTTTAACACTCTATGTGGGGAAAAAGCAGCTTGTAGAGATTGAGAAGG TTGTTCTACACCCTAACTACTCCCAGGTAGATATTGGGCTCATCAAACTCAAACAGAAGG TGTCTGTTAATGAGAGAGTGATGCCCATCTGCCTACCTTCAAAGGATTATGCAGAAGTAG GGCGTGTGGGTTATGTTTCTGGCTGGGGGCGAAATGCCAATTTTAAATTTACTGACCATC TGAAGTATGTCATGCTGCCTGTGGCTGACCAAGACCAATGCATAAGGCATTATGAAGGCA GCACAGTCCCCGAAAAGAAGACACCGAAGAGCCCTGTAGGGGTGCAGCCCATACTGAATG AACACACCTTCTGTGCTGGCATGTCTAAGTACCAAGAAGACACCTGCTATGGCGATGCGG GCAGTGCCTTTGCCGTTCACGACCTGGAGGAGGACACCTGGTATGCGACTGGGATCTTAA GCTTTGATAAGAGCTGTGCTGTGGCTGAGTATGGTGTGTATGTGAAGGTGACTTCCATCC AGGACTGGGTTCAGAAGACCATAGCTGAGAACTAATGCAAGGCTGGCCGGAAGCCCTTGC CTGAAAGCAAGATTTCAGCCTGGAAGAGGGCAAAGTGGACGGGAGTGGACAGGAGTGGAT GCGATAAGATGTGGTTTGAAGCTGATGGGTGCCAGCCCTGCATTGCTGAGTCAATCAATA AAGAGCTTTCTTTTGACCCAAAAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_001126102 |
| Insert Size | 1300 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001126102.1, NP_001119574.1 |
| RefSeq Size | 1284 bp |
| RefSeq ORF | 1044 bp |
| Locus ID | 3240 |
| UniProt ID | P00738 |
| Protein Families | Druggable Genome, Protease, Secreted Protein, Transmembrane |
| Gene Summary | This gene encodes a preproprotein, which is processed to yield both alpha and beta chains, which subsequently combine as a tetramer to produce haptoglobin. Haptoglobin functions to bind free plasma hemoglobin, which allows degradative enzymes to gain access to the hemoglobin, while at the same time preventing loss of iron through the kidneys and protecting the kidneys from damage by hemoglobin. Mutations in this gene and/or its regulatory regions cause ahaptoglobinemia or hypohaptoglobinemia. This gene has also been linked to diabetic nephropathy, the incidence of coronary artery disease in type 1 diabetes, Crohn's disease, inflammatory disease behavior, primary sclerosing cholangitis, susceptibility to idiopathic Parkinson's disease, and a reduced incidence of Plasmodium falciparum malaria. The protein encoded also exhibits antimicrobial activity against bacteria. A similar duplicated gene is located next to this gene on chromosome 16. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2014] Transcript Variant: This variant (2) lacks two alternate in-frame exons in the mid-coding region, compared to variant 1, resulting in a shorter protein (isoform 2), compared to isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC225519 | HP (Myc-DDK-tagged)-Human haptoglobin (HP), transcript variant 2 |
CNY 3,656.00 |
|
| RC225519L3 | Lenti ORF clone of Human haptoglobin (HP), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC225519L4 | Lenti ORF clone of Human haptoglobin (HP), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
| RG225519 | HP (tGFP-tagged) - Human haptoglobin (HP), transcript variant 2 |
CNY 4,370.00 |
其它Haptoglobin产品
