United States
Germany
Japan
United Kingdom
China
Ataxin 3 (ATXN3) (NM_001127696) Human Untagged Clone
CAT＃: SC322991
ATXN3 (untagged)-Human ataxin 3 (ATXN3), transcript variant ad
CNY 5,610.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | AT3; ATX3; JOS; MJD; MJD1; SCA3 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC322991 representing NM_001127696.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGAGTCCATCTTCCACGAGAAACAAGAAGGCTCACTTTGTGCTCAACATTGCCTGAATAACTTATTG CAAGGAGAATATTTTAGCCCTGTGGAATTATCCTCAATTGCACATCAGCTGGATGAGGAGGAGAGGATG AGAATGGCAGAAGGAGGAGTTACTAGTGAAGATTATCGCACGTTTTTACAGGTTATAAGCAATGCCTTG AAAGTTTGGGGTTTAGAACTAATCCTGTTCAACAGTCCAGAGTATCAGAGGCTCAGGATCGATCCTATA AATGAAAGATCATTTATATGCAATTATAAGGAACACTGGTTTACAGTTAGAAAATTAGGAAAACAGTGG TTTAACTTGAATTCTCTCTTGACGGGTCCAGAATTAATATCAGATACATATCTTGCACTTTTCTTGGCT CAATTACAACAGGAAGGTTATTCTATATTTGTCGTTAAGGGTGATCTGCCAGATTGCGAAGCTGACCAA CTCCTGCAGATGATTAGGGTCCAACAGATGCATCGACCAAAACTTATTGGAGAAGAATTAGCACAACTA AAAGAGCAAAGAGTCCATAAAACAGACCTGGAACGAGTGTTAGAAGCAAATGATGGCTCAGGAATGTTA GACGAAGATGAGGAGGATTTGCAGAGGGCTCTGGCACTAAGTCGCCAAGAAATTGACATGGAAGATGAG GAAGCAGATCTCCGCAGGGCTATTCAGCTAAGTATGCAAGGTAGTTCCAGAAACATATCTCAAGATATG ACACAGACATCAGGTACAAATCTTACTTCAGAAGAGCTTCGGAAGAGACGAGAAGCCTACTTTGAAAAA CAGCAGCAAAAGCAGCAACAGCAGCAGCAGCAGCAGCAGCAGGGGGACCTATCAGGACAGAGTTCACAT CCATGTGAAAGGCCAGCCACCAGTTCAGGAGCACTTGGGAGTGATCTAGGTGATGCTATGAGTGAAGAA GACATGCTTCAGGCAGCTGTGACCATGTCTTTAGAAACTGTCAGAAATGATTTGAAAACAGAAGGAAAA AAATAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001127696 |
| Insert Size | 1041 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001127696.1 |
| RefSeq Size | 6878 bp |
| RefSeq ORF | 1041 bp |
| Locus ID | 4287 |
| UniProt ID | P54252 |
| Protein Families | Druggable Genome, Transcription Factors |
| MW | 39.6 kDa |
| Gene Summary | Machado-Joseph disease, also known as spinocerebellar ataxia-3, is an autosomal dominant neurologic disorder. The protein encoded by this gene contains (CAG)n repeats in the coding region, and the expansion of these repeats from the normal 12-44 to 52-86 is one cause of Machado-Joseph disease. There is a negative correlation between the age of onset and CAG repeat numbers. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2016] Transcript Variant: This variant (ad, also known as variant 3) is one of several transcript variants described in figure 2 of Bettencourt et al. (PMID: 19714377). This variant encodes isoform ad (also known as isoform 3). Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC225517 | ATXN3 (Myc-DDK-tagged)-Human ataxin 3 (ATXN3), transcript variant ad |
CNY 5,488.00 |
|
| RC225517L3 | Lenti-ORF clone of ATXN3 (Myc-DDK-tagged)-Human ataxin 3 (ATXN3), transcript variant ad |
CNY 5,890.00 |
|
| RC225517L4 | Lenti-ORF clone of ATXN3 (mGFP-tagged)-Human ataxin 3 (ATXN3), transcript variant ad |
CNY 5,890.00 |
|
| RG225517 | ATXN3 (tGFP-tagged) - Human ataxin 3 (ATXN3), transcript variant ad |
CNY 7,088.00 |
其它Ataxin 3产品
