RHD (NM_001127691) Human Untagged Clone
CAT#: SC322974
RHD (untagged)-Human Rh blood group, D antigen (RHD), transcript variant 2
CNY 6,270.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CD240D; DIIIc; RH; Rh4; RH30; RHCED; RhDCw; RHDel; RHDVA(TT); RhII; RhK562-II; RhPI; RHPII; RHXIII |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001127691, the custom clone sequence may differ by one or more nucleotides
ATGAGCTCTAAGTACCCGCGGTCTGTCCGGCGCTGCCTGCCCCTCTGGGCCCTAACACTG GAAGCAGCTCTCATTCTCCTCTTCTATTTTTTTACCCACTATGACGCTTCCTTAGAGGAT CAAAAGGGGCTCGTGGCATCCTATCAAGTTGGCCAAGATCTGACCGTGATGGCGGCCATT GGCTTGGGCTTCCTCACCTCGAGTTTCCGGAGACACAGCTGGAGCAGTGTGGCCTTCAAC CTCTTCATGCTGGCGCTTGGTGTGCAGTGGGCAATCCTGCTGGACGGCTTCCTGAGCCAG TTCCCTTCTGGGAAGGTGGTCATCACACTGTTCAGTATTCGGCTGGCCACCATGAGTGCT TTGTCGGTGCTGATCTCAGTGGATGCTGTCTTGGGGAAGGTCAACTTGGCGCAGTTGGTG GTGATGGTGCTGGTGGAGGTGACAGCTTTAGGCAACCTGAGGATGGTCATCAGTAATATC TTCAACACAGACTACCACATGAACATGATGCACATCTACGTGTTCGCAGCCTATTTTGGG CTGTCTGTGGCCTGGTGCCTGCCAAAGCCTCTACCCGAGGGAACGGAGGATAAAGATCAG ACAGCAACGATACCCAGTTTGTCTGCCATGCTGGGCGCCCTCTTCTTGTGGATGTTCTGG CCAAGTTTCAACTCTGCTCTGCTGAGAAGTCCAATCGAAAGGAAGAATGCCGTGTTCAAC ACCTACTATGCTGTAGCAGTCAGCGTGGTGACAGCCATCTCAGGGTCATCCTTGGCTCAC CCCCAAGGGAAGATCAGCAAGACTTATGTGCACAGTGCGGTGTTGGCAGGAGGCGTGGCT GTGGGTACCTCGTGTCACCTGATCCCTTCTCCGTGGCTTGCCATGGTGCTGGGTCTTGTG GCTGGGCTGATCTCCGTCGGGGGAGCCAAGTACCTGCCGTTTCCTCATTTGGCTGTTGGA TTT |
Restriction Sites | Please inquire |
ACCN | NM_001127691 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001127691.1, NP_001121163.1 |
RefSeq Size | 2545 bp |
RefSeq ORF | 966 bp |
Locus ID | 6007 |
UniProt ID | Q02161 |
Protein Families | Transmembrane |
Gene Summary | The Rh blood group system is the second most clinically significant of the blood groups, second only to ABO. It is also the most polymorphic of the blood groups, with variations due to deletions, gene conversions, and missense mutations. The Rh blood group includes this gene, which encodes the RhD protein, and a second gene that encodes both the RhC and RhE antigens on a single polypeptide. The two genes, and a third unrelated gene, are found in a cluster on chromosome 1. The classification of Rh-positive and Rh-negative individuals is determined by the presence or absence of the highly immunogenic RhD protein on the surface of erythrocytes. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2), also known as del789, lacks three alternate coding exons compared to variant 1. The resulting isoform (2) has the same N- and C-termini but is shorter compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225464 | RHD (Myc-DDK-tagged)-Human Rh blood group, D antigen (RHD), transcript variant 2 |
CNY 3,990.00 |
|
RC225464L3 | Lenti-ORF clone of RHD (Myc-DDK-tagged)-Human Rh blood group, D antigen (RHD), transcript variant 2 |
CNY 5,890.00 |
|
RC225464L4 | Lenti-ORF clone of RHD (mGFP-tagged)-Human Rh blood group, D antigen (RHD), transcript variant 2 |
CNY 5,890.00 |
|
RG225464 | RHD (tGFP-tagged) - Human Rh blood group, D antigen (RHD), transcript variant 2 |
CNY 4,370.00 |