Carbonic Anhydrase I (CA1) (NM_001128831) Human Untagged Clone
CAT#: SC322930
CA1 (untagged)-Human carbonic anhydrase I (CA1), transcript variant 4
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CA-I; CAB; Car1; HEL-S-11 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001128831, the custom clone sequence may differ by one or more nucleotides
ATGGCAAGTCCAGACTGGGGATATGATGACAAAAATGGTCCTGAACAATGGAGCAAGCTG TATCCCATTGCCAATGGAAATAACCAGTCCCCTGTTGATATTAAAACCAGTGAAACCAAA CATGACACCTCTCTGAAACCTATTAGTGTCTCCTACAACCCAGCCACAGCCAAAGAAATT ATCAATGTGGGGCATTCCTTCCATGTAAATTTTGAGGACAACGATAACCGATCAGTGCTG AAAGGTGGTCCTTTCTCTGACAGCTACAGGCTCTTTCAGTTCCATTTTCACTGGGGCAGT ACAAATGAGCATGGTTCAGAACATACAGTGGATGGAGTCAAATATTCTGCCGAGCTTCAC GTAGCTCACTGGAATTCTGCAAAGTACTCCAGCCTTGCTGAAGCTGCCTCAAAGGCTGAT GGTTTGGCAGTTATTGGTGTTTTGATGAAGGTTGGTGAGGCCAACCCAAAGCTGCAGAAA GTACTTGATGCCCTCCAAGCAATTAAAACCAAGGGCAAACGAGCCCCATTCACAAATTTT GACCCCTCTACTCTCCTTCCTTCATCCCTGGATTTCTGGACCTACCCTGGCTCTCTGACT CATCCTCCTCTTTATGAGAGTGTAACTTGGATCATCTGTAAGGAGAGCATCAGTGTCAGC TCAGAGCAGCTGGCACAATTCCGCAGCCTTCTATCAAATGTTGAAGGTGATAACGCTGTC CCCATGCAGCACAACAACCGCCCAACCCAACCTCTGAAGGGCAGAACAGTGAGAGCTTCA TTT |
Restriction Sites | Please inquire |
ACCN | NM_001128831 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001128831.1, NP_001122303.1 |
RefSeq Size | 1156 bp |
RefSeq ORF | 786 bp |
Locus ID | 759 |
UniProt ID | P00915 |
Protein Families | Druggable Genome |
Protein Pathways | Nitrogen metabolism |
Gene Summary | Carbonic anhydrases (CAs) are a large family of zinc metalloenzymes that catalyze the reversible hydration of carbon dioxide. They participate in a variety of biological processes, including respiration, calcification, acid-base balance, bone resorption, and the formation of aqueous humor, cerebrospinal fluid, saliva and gastric acid. They show extensive diversity in tissue distribution and in their subcellular localization. This CA1 gene is closely linked to the CA2 and CA3 genes on chromosome 8. It encodes a cytosolic protein that is found at the highest level in erythrocytes. Allelic variants of this gene have been described in some populations. Alternative splicing and the use of alternative promoters results in multiple transcript variants. [provided by RefSeq, Nov 2016] Transcript Variant: This variant (4) differs in the 5' UTR compared to variant 3. Variants 1, 2, 3, 4 and 5 all encode isoform a. This variant represents use of an upstream long terminal repeat (LTR) promoter and exon sequence, and results in erythroid expression. (PMID: 1908227). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225351 | CA1 (Myc-DDK-tagged)-Human carbonic anhydrase I (CA1), transcript variant 4 |
CNY 2,400.00 |
|
RC225351L3 | Lenti-ORF clone of CA1 (Myc-DDK-tagged)-Human carbonic anhydrase I (CA1), transcript variant 4 |
CNY 5,890.00 |
|
RC225351L4 | Lenti-ORF clone of CA1 (mGFP-tagged)-Human carbonic anhydrase I (CA1), transcript variant 4 |
CNY 5,890.00 |
|
RG225351 | CA1 (tGFP-tagged) - Human carbonic anhydrase I (CA1), transcript variant 4 |
CNY 4,370.00 |