ORAI2 (NM_001126340) Human Untagged Clone

CAT#: SC322922

ORAI2 (untagged)-Human ORAI calcium release-activated calcium modulator 2 (ORAI2), transcript variant 1



  "NM_001126340" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
ORAI2 mouse monoclonal antibody, clone OTI8D11 (formerly 8D11)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms C7orf19; CBCIP2; MEM142B; TMEM142B
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC322922 representing NM_001126340.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAGTGCTGAGCTTAACGTGCCTATCGACCCCTCTGCTCCTGCCTGCCCTGAGCCCGGCCATAAGGGC
ATGGATTACCGGGACTGGGTCCGCCGCAGCTACCTGGAACTGGTCACCTCTAACCACCACTCGGTACAG
GCCCTGTCGTGGCGGAAGCTCTACCTGAGCAGGGCCAAGCTGAAGGCCTCCAGCAGGACCTCCGCCCTC
CTCTCCGGCTTTGCCATGGTGGCCATGGTGGAGGTGCAGCTGGAGACGCAGTACCAGTACCCGCGGCCG
CTGCTGATTGCCTTCAGCGCCTGCACCACGGTGCTGGTGGCCGTGCACCTGTTCGCCCTCCTCATCAGC
ACCTGCATCCTGCCCAATGTGGAGGCCGTGAGCAACATCCACAACCTGAACTCCATCAGCGAGTCCCCG
CATGAGCGCATGCACCCCTACATCGAGCTGGCCTGGGGCTTCTCCACCGTGCTTGGCATCCTACTCTTC
CTGGCCGAGGTGGTGCTGCTCTGCTGGATCAAGTTCCTCCCCGTGGATGCCCGGCGCCAGCCTGGCCCC
CCACCTGGCCCTGGGAGTCACACGGGCTGGCAGGCCGCCCTGGTGTCCACCATCATCATGGTGCCCGTG
GGCCTCATCTTCGTGGTCTTCACCATCCACTTCTACCGCTCCCTGGTGCGCCACAAAACGGAGCGCCAC
AACCGCGAGATCGAGGAGCTCCACAAGCTCAAGGTCCAGCTGGACGGGCATGAGCGCAGCCTGCAGGTC
TTGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001126340
Insert Size 765 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001126340.2
RefSeq Size 10788 bp
RefSeq ORF 765 bp
Locus ID 80228
UniProt ID Q96SN7
Protein Families Transmembrane
MW 28.6 kDa
Gene Summary Ca(2+) release-activated Ca(2+)-like (CRAC-like) channel subunit which mediates Ca(2+) influx and increase in Ca(2+)-selective current by synergy with the Ca(2+) sensor, STIM1.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) differs in the 5' UTR compared to variant 3. Variants 1, 2, and 3 all encode the same isoform (a). Sequence Note: This RefSeq record was created from transcript and genomic sequence data because transcript sequence consistent with the reference genome assembly was not available for all regions of the RefSeq transcript. The extent of this transcript is supported by transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...