Troponin T1 (TNNT1) (NM_001126133) Human Untagged Clone

CAT#: SC322919

TNNT1 (untagged)-Human troponin T type 1 (skeletal, slow) (TNNT1), transcript variant 3



  "NM_001126133" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


TNNT1 rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ANM; NEM5; STNT; TNT; TNTS
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC322919 representing NM_001126133.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTCGGACACCGAGGAGCAGGAATATGAGGAGGAGCAGCCGGAAGAGGAGGCTGCGGAGGAGGAGGAG
GAAGAAGAGGAACGCCCCAAACCAAGCCGCCCCGTGGTGCCTCCTTTGATCCCGCCAAAGATCCCAGAA
GGGGAGCGCGTTGACTTCGATGACATCCACCGCAAGCGCATGGAGAAAGACCTGCTGGAGCTGCAGACA
CTCATCGATGTACATTTCGAGCAGCGGAAGAAGGAGGAAGAGGAGCTGGTTGCCTTGAAGGAGCGCATT
GAGCGGCGCCGGTCAGAGAGAGCCGAGCAACAGCGCTTCAGAACTGAGAAGGAACGCGAACGTCAGGCT
AAGCTGGCGGAGGAGAAGATGAGGAAGGAAGAGGAAGAGGCCAAGAAGCGGGCAGAGGATGATGCCAAG
AAAAAGAAGGTGCTGTCCAACATGGGGGCCCATTTTGGCGGCTACCTGGTCAAGGCAGAACAGAAGCGT
GGTAAGCGGCAGACGGGGCGGGAGATGAAGGTGCGCATCCTCTCCGAGCGTAAGAAGCCTCTGGACATT
GACTACATGGGGGAGGAACAGCTCCGGGAGAAAGCCCAGGAGCTGTCGGACTGGATCCACCAGCTGGAG
TCTGAGAAGTTCGACCTGATGGCGAAGCTGAAACAGCAGAAATATGAGATCAACGTGCTGTACAACCGC
ATCAGCCACGCCCAGAAGTTCCGGAAGGGGGCAGGGAAGGGCCGCGTTGGAGGCCGCTGGAAGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001126133
Insert Size 756 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001126133.2
RefSeq Size 1178 bp
RefSeq ORF 756 bp
Locus ID 7138
UniProt ID P13805
Protein Families Druggable Genome
MW 30.1 kDa
Gene Summary This gene encodes a protein that is a subunit of troponin, which is a regulatory complex located on the thin filament of the sarcomere. This complex regulates striated muscle contraction in response to fluctuations in intracellular calcium concentration. This complex is composed of three subunits: troponin C, which binds calcium, troponin T, which binds tropomyosin, and troponin I, which is an inhibitory subunit. This protein is the slow skeletal troponin T subunit. Mutations in this gene cause nemaline myopathy type 5, also known as Amish nemaline myopathy, a neuromuscular disorder characterized by muscle weakness and rod-shaped, or nemaline, inclusions in skeletal muscle fibers which affects infants, resulting in death due to respiratory insufficiency, usually in the second year. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (3) lacks an alternate in-frame exon in the 5' coding region, and uses an alternate in-frame splice site in the 3' coding region, compared to variant 1, resulting in an isoform (c) that is shorter than isoform a. Both variants 3 and 4 encode isoform c.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...