FAM119A (METTL21A) (NM_001127395) Human Untagged Clone

CAT#: SC322903

METTL21A (untagged)-Human methyltransferase like 21A (METTL21A), transcript variant 2



  "NM_001127395" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
FAM119A mouse monoclonal antibody, clone OTI2G7 (formerly 2G7)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms FAM119A; HCA557b; HSPA-KMT
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC322903 representing NM_001127395.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCCCTCGTGCCCTATGAGGAGACCACGGAATTTGGGTTGCAGAAATTCCACAAGCCTCTTGCAACT
TTTTCCTTTGCAAACCACACGATCCAGATCCGGCAGGACTGGAGACACCTGGGAGTCGCAGCGGTGGTT
TGGGATGCGGCCATCGTTCTTTCCACATACCTGGAGATGGGAGCTGTGGAGCTCAGGGGCCGCTCTGCC
GTGGAGCTGGGTGCTGGCACGGGGCTGGTGGGCATAGTGGCTGCCCTGCTGGGTGCTCATGTGACTATC
ACGGATCGAAAAGTAGCATTAGAATTTCTTAAATCAAACGTTCAAGCCAACTTACCTCCTCATATCCAA
ACTAAAACTGTTGTTAAGGAGCTGACTTGGGGACAAAATTTGGGGAGTTTTTCTCCTGGAGAATTTGAC
CTGATACTTGGTGCTGATATCATATATTTAGAAGAAACATTCACAGATCTTCTTCAGACACTGGAACAT
CTCTGTAGCAATCACTCTGTGATTCTTTTAGCATGCCGAATTCGCTATGAACGGGATAACAACTTCTTA
GCAATGCTGGAGAGGCAATTTACTGTGAGAAAGGTTCACTACGATCCTGAAAAAGATGTACATATTTAC
GAAGCACAGAAGAGAAACCAGAAGGAGGACTTATAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001127395
Insert Size 657 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001127395.2
RefSeq Size 4897 bp
RefSeq ORF 657 bp
Locus ID 151194
UniProt ID Q8WXB1
MW 24.6 kDa
Gene Summary Protein-lysine methyltransferase that selectively trimethylates residues in heat shock protein 70 (HSP70) family members. Contributes to the in vivo trimethylation of Lys residues in HSPA1 and HSPA8. In vitro methylates 'Lys-561' in HSPA1, 'Lys-564' in HSPA2, 'Lys-585' in HSPA5, 'Lys-563' in HSPA6 and 'Lys-561' in HSPA8.[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...