MAD2L2 (NM_001127325) Human Untagged Clone
CAT#: SC322901
MAD2L2 (untagged)-Human MAD2 mitotic arrest deficient-like 2 (yeast) (MAD2L2), transcript variant 1
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | FANCV; MAD2B; POLZ2; REV7 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC322901 representing NM_001127325.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGACCACGCTCACACGACAAGACCTCAACTTTGGCCAAGTGGTGGCCGATGTGCTCTGCGAGTTCCTG GAGGTGGCTGTGCATCTCATCCTCTACGTGCGCGAGGTCTACCCCGTGGGCATCTTCCAGAAACGCAAG AAGTACAACGTGCCGGTCCAGATGTCCTGCCACCCGGAGCTGAATCAGTATATCCAGGACACGCTGCAC TGCGTCAAGCCACTCCTGGAGAAGAATGATGTGGAGAAAGTGGTGGTGGTGATTTTGGATAAAGAGCAC CGCCCAGTGGAGAAATTCGTCTTTGAGATCACCCAGCCTCCACTGCTGTCCATCAGCTCAGACTCGCTG TTGTCTCATGTGGAGCAGCTGCTCCGGGCCTTCATCCTGAAGATCAGCGTGTGCGATGCCGTCCTGGAC CACAACCCCCCAGGCTGTACCTTCACAGTCCTGGTGCACACGAGAGAAGCCGCCACTCGCAACATGGAG AAGATCCAGGTCATCAAGGATTTCCCCTGGATCCTGGCGGATGAGCAGGATGTCCACATGCATGACCCC CGGCTGATACCACTAAAAACCATGACGTCGGACATTTTAAAGATGCAGCTTTACGTGGAAGAGCGCGCT CATAAAGGCAGCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001127325 |
Insert Size | 636 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001127325.1 |
RefSeq Size | 1196 bp |
RefSeq ORF | 636 bp |
Locus ID | 10459 |
UniProt ID | Q9UI95 |
Protein Families | Druggable Genome |
Protein Pathways | Cell cycle, Oocyte meiosis, Progesterone-mediated oocyte maturation |
MW | 24.3 kDa |
Gene Summary | The protein encoded by this gene is a component of the mitotic spindle assembly checkpoint that prevents the onset of anaphase until all chromosomes are properly aligned at the metaphase plate. The encoded protein, which is similar to MAD2L1, is capable of interacting with ADAM9, ADAM15, REV1, and REV3 proteins. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1) has the 5'-most first exon. Variants 1 and 2 both encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225253 | MAD2L2 (Myc-DDK-tagged)-Human MAD2 mitotic arrest deficient-like 2 (yeast) (MAD2L2), transcript variant 1 |
CNY 2,400.00 |
|
RC225253L3 | Lenti ORF clone of Human MAD2 mitotic arrest deficient-like 2 (yeast) (MAD2L2), transcript variant 1, Myc-DDK-tagged |
CNY 4,800.00 |
|
RC225253L4 | Lenti ORF clone of Human MAD2 mitotic arrest deficient-like 2 (yeast) (MAD2L2), transcript variant 1, mGFP tagged |
CNY 4,800.00 |
|
RG225253 | MAD2L2 (tGFP-tagged) - Human MAD2 mitotic arrest deficient-like 2 (yeast) (MAD2L2), transcript variant 1 |
CNY 4,370.00 |