RWDD3 (NM_001128142) Human Untagged Clone

CAT#: SC322884

RWDD3 (untagged)-Human RWD domain containing 3 (RWDD3), transcript variant 2



  "NM_001128142" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


RWDD3 mouse monoclonal antibody,clone OTI10H4
    • 100 ul

CNY 1,999.00
CNY 2,700.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms RSUME
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC322884 representing NM_001128142.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCGGAGCCTGTGCAGGAGGAGCTCTCGGTCCTGGCCGCGATTTTCTGCAGGCCCCACGAGTGGGAG
GTGCTGAGCCGCTCAGAGACAGATGGGACCGTGTTCAGAATTCACACAAAAGCTGAAGGATTTATGGAT
GCGGATATACCTCTGGAATTGGTGTTCCATTTGCCAGTCAATTATCCTTCATGTCTACCTGGTATCTCG
ATTAACTCTGAACAGTTGACCAGGGCCCAGTGTGTGACTGTGAAAGAGAATTTACTTGAGCAAGCAGAG
AGCCTTTTGTCGGAGCCTATGGTTCATGAGCTGGTTCTCTGGATTCAGCAGAATCTCAGGCATATCCTC
AGCCAACCAGAAACTGGCAGTGGCAGTGAAAAGTGTACTTTTTCAACAAGCACGACCATGGATGATGGA
TTGTGGATAACTCTTTTGCATTTAGATCACATGAGAGCAAAGACTAAATATGTCAAAATTGTGGAGAAG
TGGGCTTCAGATTTAAGGCTGACAGGAAGACTGATGTTCATGGGTAAAATAATACTGATTTTACTACAG
GGAGACAGAAACAACCTCAAGGTGCCAAAAAGTTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001128142
Insert Size 588 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001128142.1
RefSeq Size 1151 bp
RefSeq ORF 588 bp
Locus ID 25950
UniProt ID Q9Y3V2
MW 22.1 kDa
Gene Summary Enhancer of SUMO conjugation. Via its interaction with UBE2I/UBC9, increases SUMO conjugation to proteins by promoting the binding of E1 and E2 enzymes, thioester linkage between SUMO and UBE2I/UBC9 and transfer of SUMO to specific target proteins which include HIF1A, PIAS, NFKBIA, NR3C1 and TOP1. Isoform 1 and isoform 2 positively regulate the NF-kappa-B signaling pathway by enhancing the sumoylation of NF-kappa-B inhibitor alpha (NFKBIA), promoting its stabilization which consequently leads to an increased inhibition of NF-kappa-B transcriptional activity. Isoform 1 and isoform 2 negatively regulate the hypoxia-inducible factor-1 alpha (HIF1A) signaling pathway by increasing the sumoylation of HIF1A, promoting its stabilization, transcriptional activity and the expression of its target gene VEGFA during hypoxia. Isoform 2 promotes the sumoylation and transcriptional activity of the glucocorticoid receptor NR3C1 and enhances the interaction of SUMO1 and NR3C1 with UBE2I/UBC9. Has no effect on ubiquitination.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) uses an alternate splice site and lacks an alternate exon in the 3' coding region, which results in a frameshift, compared to variant 1. The encoded isoform (b) is shorter and has a distinct C-terminus, compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...