HP1 alpha (CBX5) (NM_001127321) Human Untagged Clone
CAT#: SC322879
CBX5 (untagged)-Human chromobox homolog 5 (CBX5), transcript variant 2
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | HEL25; HP1; HP1A |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC322879 representing NM_001127321.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGGAAAGAAAACCAAGCGGACAGCTGACAGTTCTTCTTCAGAGGATGAGGAGGAGTATGTTGTGGAG AAGGTGCTAGACAGGCGCGTGGTTAAGGGACAAGTGGAATATCTACTGAAGTGGAAAGGCTTTTCTGAG GAGCACAATACTTGGGAACCTGAGAAAAACTTGGATTGCCCTGAGCTAATTTCTGAATTTATGAAAAAG TATAAGAAGATGAAGGAGGGTGAAAATAATAAACCCAGGGAGAAGTCAGAAAGTAACAAGAGGAAATCC AATTTCTCAAACAGTGCCGATGACATCAAATCTAAAAAAAAGAGAGAGCAGAGCAATGATATCGCTCGG GGCTTTGAGAGAGGACTGGAACCAGAAAAGATCATTGGGGCAACAGATTCCTGTGGTGATTTAATGTTC CTAATGAAATGGAAAGACACAGATGAAGCTGACCTGGTTCTTGCAAAAGAAGCTAATGTGAAATGTCCA CAAATTGTGATAGCATTTTATGAAGAGAGACTGACATGGCATGCATATCCTGAGGATGCGGAAAACAAA GAGAAAGAAACAGCAAAGAGCTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001127321 |
Insert Size | 576 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001127321.1 |
RefSeq Size | 11525 bp |
RefSeq ORF | 576 bp |
Locus ID | 23468 |
UniProt ID | P45973 |
MW | 22.2 kDa |
Gene Summary | This gene encodes a highly conserved nonhistone protein, which is a member of the heterochromatin protein family. The protein is enriched in the heterochromatin and associated with centromeres. The protein has a single N-terminal chromodomain which can bind to histone proteins via methylated lysine residues, and a C-terminal chromo shadow-domain (CSD) which is responsible for the homodimerization and interaction with a number of chromatin-associated nonhistone proteins. The encoded product is involved in the formation of functional kinetochore through interaction with essential kinetochore proteins. The gene has a pseudogene located on chromosome 3. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1, 2 and 3 encode the same protein. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence and transcripts to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225208 | CBX5 (Myc-DDK-tagged)-Human chromobox homolog 5 (CBX5), transcript variant 2 |
CNY 2,400.00 |
|
RC225208L1 | Lenti ORF clone of Human chromobox homolog 5 (CBX5), transcript variant 2, Myc-DDK-tagged |
CNY 4,800.00 |
|
RC225208L2 | Lenti ORF clone of Human chromobox homolog 5 (CBX5), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RC225208L3 | Lenti ORF clone of Human chromobox homolog 5 (CBX5), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC225208L4 | Lenti ORF clone of Human chromobox homolog 5 (CBX5), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG225208 | CBX5 (tGFP-tagged) - Human chromobox homolog 5 (CBX5), transcript variant 2 |
CNY 4,370.00 |
其它HP1 alpha产品