HRASLS3 (PLA2G16) (NM_001128203) Human Untagged Clone
CAT#: SC322857
PLA2G16 (untagged)-Human phospholipase A2, group XVI (PLA2G16), transcript variant 2
CNY 3,990.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | AdPLA; H-REV107; H-REV107-1; HRASLS3; HREV107; HREV107-1; HREV107-3; HRSL3; PLA2G16; PLAAT-3 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC322857 representing NM_001128203.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCGTGCGCCCATTCCAGAGCCTAAGCCTGGAGACCTGATTGAGATTTTTCGCCCTTTCTACAGACAC TGGGCCATCTATGTTGGCGATGGATATGTGGTTCATCTGGCCCCTCCAAGTGAGGTCGCAGGAGCTGGT GCAGCCAGTGTCATGTCCGCCCTGACTGACAAGGCCATCGTGAAGAAGGAATTGCTGTATGATGTGGCC GGGAGTGACAAGTACCAGGTCAACAACAAACATGATGACAAGTACTCGCCGCTGCCCTGCAGCAAAATC ATCCAGCGGGCGGAGGAGCTGGTGGGGCAGGAGGTGCTCTACAAGCTGACCAGTGAGAACTGCGAGCAC TTTGTGAATGAGCTGCGCTATGGAGTCGCCCGCAGTGACCAGGTCAGAGATGTCATCATCGCTGCAAGC GTTGCAGGAATGGGCTTGGCAGCCATGAGCCTTATTGGAGTCATGTTCTCAAGAAACAAGCGACAAAAG CAATAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001128203 |
Insert Size | 489 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001128203.1 |
RefSeq Size | 1111 bp |
RefSeq ORF | 489 bp |
Locus ID | 11145 |
UniProt ID | P53816 |
Protein Families | Druggable Genome, Transmembrane |
MW | 17.9 kDa |
Gene Summary | Exhibits both phospholipase A1/2 and acyltransferase activities (PubMed:19615464, PubMed:19047760, PubMed:22825852, PubMed:22605381, PubMed:26503625). Shows phospholipase A1 (PLA1) and A2 (PLA2) activity, catalyzing the calcium-independent release of fatty acids from the sn-1 or sn-2 position of glycerophospholipids (PubMed:19615464, PubMed:19047760, PubMed:22825852, PubMed:22605381, PubMed:22923616). For most substrates, PLA1 activity is much higher than PLA2 activity (PubMed:19615464). Shows O-acyltransferase activity,catalyzing the transfer of a fatty acyl group from glycerophospholipid to the hydroxyl group of lysophospholipid (PubMed:19615464). Shows N-acyltransferase activity, catalyzing the calcium-independent transfer of a fatty acyl group at the sn-1 position of phosphatidylcholine (PC) and other glycerophospholipids to the primary amine of phosphatidylethanolamine (PE), forming N-acylphosphatidylethanolamine (NAPE), which serves as precursor for N-acylethanolamines (NAEs) (PubMed:19615464, PubMed:19047760, PubMed:22825852, PubMed:22605381). Exhibits high N-acyltransferase activity and low phospholipase A1/2 activity (PubMed:22825852).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 and 2 encode the same isoform. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225152 | PLA2G16 (Myc-DDK-tagged)-Human phospholipase A2, group XVI (PLA2G16), transcript variant 2 |
CNY 1,200.00 |
|
RC225152L3 | Lenti ORF clone of Human phospholipase A2, group XVI (PLA2G16), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC225152L4 | Lenti ORF clone of Human phospholipase A2, group XVI (PLA2G16), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG225152 | PLA2G16 (tGFP-tagged) - Human phospholipase A2, group XVI (PLA2G16), transcript variant 2 |
CNY 4,370.00 |
其它HRASLS3产品