Cytochrome b reductase 1 (CYBRD1) (NM_001127383) Human Untagged Clone
CAT#: SC322853
CYBRD1 (untagged)-Human cytochrome b reductase 1 (CYBRD1), transcript variant 2
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CYB561A2; DCYTB; FRRS3 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC322853 representing NM_001127383.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCCATGGAGGGCTACTGGCGCTTCCTGGCGCTGCTGGGGTCGGCACTGCTCGTCGGCTTCCTGTCG GTGATCTTCGCCCTCGTCTGGGTCCTCCACTACCGAGAGGGGCTTGGCTGGGATGGGAGCGCACTAGAG TTTAACTGGCACCCAGTGCTCATGGTCACCGGCTTCGTCTTCATCCAGGGCATCGCTTCTTTCAGGTTT TTCAGTCTTTCTGCTTCCATGGGCTCCGCTTTCTCTCCGAGCATTTCTCATGCCCATACATGTTTATTC TGGAATTGTCATCTTTGGAACAGTGATTGCAACAGCACTTATGGGATTGACAGAGAAACTGATTTTTTC CCTGAGAGATCCTGCATACAGTACATTCCCGCCAGAAGGTGTTTTCGTAAATACGCTTGGCCTTCTGAT CCTGGTGTTCGGGGCCCTCATTTTTTGGATAGTCACCAGACCGCAATGGAAACGTCCTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001127383 |
Insert Size | 474 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001127383.1 |
RefSeq Size | 4153 bp |
RefSeq ORF | 474 bp |
Locus ID | 79901 |
UniProt ID | Q53TN4 |
Protein Families | Transmembrane |
MW | 17.9 kDa |
Gene Summary | This gene is a member of the cytochrome b(561) family that encodes an iron-regulated protein. It highly expressed in the duodenal brush border membrane. It has ferric reductase activity and is believed to play a physiological role in dietary iron absorption. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) lacks an alternate exon that results in a frameshift in the central and 3' coding regions, compared to variant 1. The encoded isoform (2) has a distinct and shorter C-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225139 | CYBRD1 (Myc-DDK-tagged)-Human cytochrome b reductase 1 (CYBRD1), transcript variant 2 |
CNY 1,200.00 |
|
RC225139L1 | Lenti ORF clone of Human cytochrome b reductase 1 (CYBRD1), transcript variant 2, Myc-DDK-tagged |
CNY 3,600.00 |
|
RC225139L2 | Lenti ORF clone of Human cytochrome b reductase 1 (CYBRD1), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RC225139L3 | Lenti ORF clone of Human cytochrome b reductase 1 (CYBRD1), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC225139L4 | Lenti ORF clone of Human cytochrome b reductase 1 (CYBRD1), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG225139 | CYBRD1 (tGFP-tagged) - Human cytochrome b reductase 1 (CYBRD1), transcript variant 2 |
CNY 4,370.00 |
其它Cytochrome b reductase 1产品