United States
Germany
Japan
United Kingdom
China
FXYD2 (NM_001127489) Human Untagged Clone
CAT＃: SC322850
FXYD2 (untagged)-Human FXYD domain containing ion transport regulator 2 (FXYD2), transcript variant c
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | ATP1G1; HOMG2; MGC12372 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC322850 representing NM_001127489.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGACTGGGTTGTCGATGGACGGTGGCGGCAGCCCCAAGGGGGACGTGGACCCGTTCTACTATGGTAAG CCTGGGCCCCTGCGCACCCTTCCTGAGCCCTCAGGACCCCTTCCACCAAGCAGCGGCCTCTCCCAGCCC CAGGTCCATGCTCTGTGCCCCTTATCTCCCCTGGTTACCACGGGCTGCTGCGGGCAGGCTGCGGAGAGA GACAGCTGCTGGGAGAGACCACCCATCCCGCTCCTCTTGCCCTCTCTTTCCGGAGACTATGAGACCGTT CGCAATGGGGGCCTGATCTTCGCTGGACTGGCCTTCATCGTGGGGCTCCTCATCCTCCTCAGTAAGTGG GGTGGCCTCCAGGGAAGGGGTGCTGACCAGGGCACCTCTCTTCTCAAGGCCGCTGAGCAGGCTGGCTTT CGGGAGTTGCCAAGGGAGGGGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001127489 |
| Insert Size | 438 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001127489.1 |
| RefSeq Size | 2747 bp |
| RefSeq ORF | 438 bp |
| Locus ID | 486 |
| Protein Families | Druggable Genome, Ion Channels: Other, Transmembrane |
| MW | 15.1 kDa |
| Gene Summary | This gene encodes a member of the FXYD family of transmembrane proteins. This particular protein encodes the sodium/potassium-transporting ATPase subunit gamma. Mutations in this gene have been associated with Renal Hypomagnesemia-2. Alternatively spliced transcript variants have been described. Read-through transcripts have been observed between this locus and the upstream FXYD domain-containing ion transport regulator 6 (FXYD6, GeneID 53826) locus.[provided by RefSeq, Feb 2011] Transcript Variant: This variant (c) is missing several coding exons at the 3' end and contains a different 3' terminal exon compared to transcript variant a. This results in a longer isoform (3) with a novel internal segment and a different C-terminus, compared to isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC225122 | FXYD2 (Myc-DDK-tagged)-Human FXYD domain containing ion transport regulator 2 (FXYD2), transcript variant c |
CNY 1,200.00 |
|
| RC225122L1 | Lenti ORF clone of Human FXYD domain containing ion transport regulator 2 (FXYD2), transcript variant c, Myc-DDK-tagged |
CNY 3,600.00 |
|
| RC225122L2 | Lenti ORF clone of Human FXYD domain containing ion transport regulator 2 (FXYD2), transcript variant c, mGFP tagged |
CNY 5,890.00 |
|
| RC225122L3 | Lenti ORF clone of Human FXYD domain containing ion transport regulator 2 (FXYD2), transcript variant c, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC225122L4 | Lenti ORF clone of Human FXYD domain containing ion transport regulator 2 (FXYD2), transcript variant c, mGFP tagged |
CNY 5,890.00 |
|
| RG225122 | FXYD2 (tGFP-tagged) - Human FXYD domain containing ion transport regulator 2 (FXYD2), transcript variant c |
CNY 4,370.00 |
