Bcl2 Binding component 3 (BBC3) (NM_001127241) Human Untagged Clone
CAT#: SC322840
BBC3 (untagged)-Human BCL2 binding component 3 (BBC3), transcript variant 2
CNY 1,200.00
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | JFY-1; JFY1; PUMA |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_001127241 edited
ATGAAATTTGGCATGGGGTCTGCCCAGGCATGTCCATGCCAGGTGCCCAGGGCTGCTTCC ACGACGTGGGTCCCCTGCCAGATTTGTGGTCCTCAGCCCTCGCTCTCGCTGGCGGAGCAG CACCTGGAGTCGCCCGTGCCCAGCGCCCCGGGGGCTCTGGCGGGCGGTCCCACCCAGGCG GCCCCGGGAGTCCGCGGGGAGGAGGAACAGTGGGCCCGGGAGATCGGGGCCCAGCTGCGG CGGATGGCGGACGACCTCAACGCACAGTACGAGCGGCGGAGACAAGAGGAGCAGCAGCGG CACCGCCCCTCACCCTGGAGGGTCCTGTACAATCTCATCATGGGACTCCTGCCCTTACCC AGGGGCCACAGAGCCCCCGAGATGGAGCCCAATTAG |
Restriction Sites | Please inquire |
ACCN | NM_001127241 |
Insert Size | 1550 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001127241.1. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001127241.1, NP_001120713.1 |
RefSeq Size | 1550 bp |
RefSeq ORF | 396 bp |
Locus ID | 27113 |
UniProt ID | Q9BXH1 |
Protein Families | Druggable Genome |
Protein Pathways | Huntington's disease, p53 signaling pathway |
Gene Summary | This gene encodes a member of the BCL-2 family of proteins. This family member belongs to the BH3-only pro-apoptotic subclass. The protein cooperates with direct activator proteins to induce mitochondrial outer membrane permeabilization and apoptosis. It can bind to anti-apoptotic Bcl-2 family members to induce mitochondrial dysfunction and caspase activation. Because of its pro-apoptotic role, this gene is a potential drug target for cancer therapy and for tissue injury. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2011] Transcript Variant: This variant (2) encodes isoform 2 (also known as PUMA-beta), which includes the C-terminal BH3 domain and can localize to the mitochondria. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225093 | BBC3 (Myc-DDK-tagged)-Human BCL2 binding component 3 (BBC3), transcript variant 2 |
CNY 3,990.00 |
|
RC225093L3 | Lenti-ORF clone of BBC3 (Myc-DDK-tagged)-Human BCL2 binding component 3 (BBC3), transcript variant 2 |
CNY 5,890.00 |
|
RC225093L4 | Lenti-ORF clone of BBC3 (mGFP-tagged)-Human BCL2 binding component 3 (BBC3), transcript variant 2 |
CNY 5,890.00 |
|
RG225093 | BBC3 (tGFP-tagged) - Human BCL2 binding component 3 (BBC3), transcript variant 2 |
CNY 4,370.00 |
其它Bcl2 Binding component 3产品