United States
Germany
Japan
United Kingdom
China
YPEL5 (NM_001127400) Human Untagged Clone
CAT＃: SC322822
YPEL5 (untagged)-Human yippee-like 5 (Drosophila) (YPEL5), transcript variant 2
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CGI-127 |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_001127400, the custom clone sequence may differ by one or more nucleotides
ATGGGCAGAATTTTCCTTGATCATATCGGTGGTACCCGTCTGTTTTCTTGTGCAAACTGT GATACGATCCTGACCAACCGCTCAGAACTCATCTCCACTCGTTTCACAGGCGCCACTGGC AGAGCATTTCTTTTTAACAAGGTAGTTAACCTGCAGTACAGTGAAGTTCAAGATCGGGTC ATGCTCACTGGCCGCCACATGGTTCGAGATGTGAGCTGCAAAAACTGCAATAGCAAACTG GGATGGATCTATGAGTTTGCCACTGAAGACAGCCAGCGATATAAGGAAGGCCGCGTGATC CTGGAACGTGCTCTAGTTCGAGAGAGTGAGGGCTTTGAGGAGCATGTACCATCTGATAAC TCT |
| Restriction Sites | Please inquire |
| ACCN | NM_001127400 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001127400.1, NP_001120872.1 |
| RefSeq Size | 2578 bp |
| RefSeq ORF | 366 bp |
| Locus ID | 51646 |
| UniProt ID | P62699 |
| Gene Summary | Component of the CTLH E3 ubiquitin-protein ligase complex that selectively accepts ubiquitin from UBE2H and mediates ubiquitination and subsequent proteasomal degradation of the transcription factor HBP1 (PubMed:29911972). Required for normal cell proliferation (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) lacks an alternate exon in the 5' UTR, compared to variant 1. Variants 1, 2, 3, and 4 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC225060 | YPEL5 (Myc-DDK-tagged)-Human yippee-like 5 (Drosophila) (YPEL5), transcript variant 2 |
CNY 1,200.00 |
|
| RC225060L3 | Lenti-ORF clone of YPEL5 (Myc-DDK-tagged)-Human yippee-like 5 (Drosophila) (YPEL5), transcript variant 2 |
CNY 5,890.00 |
|
| RC225060L4 | Lenti-ORF clone of YPEL5 (mGFP-tagged)-Human yippee-like 5 (Drosophila) (YPEL5), transcript variant 2 |
CNY 5,890.00 |
|
| RG225060 | YPEL5 (tGFP-tagged) - Human yippee-like 5 (Drosophila) (YPEL5), transcript variant 2 |
CNY 4,370.00 |
