TRAPPC2 (NM_001128835) Human Untagged Clone

CAT#: SC322801

TRAPPC2 (untagged)-Human trafficking protein particle complex 2 (TRAPPC2), transcript variant 3



  "NM_001128835" in other vectors (4)

CNY 3,990.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-TRAPPC2 Antibody
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms hYP38334; MIP2A; SEDL; SEDT; TRAPPC2P1; TRS20; ZNF547L
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001128835, the custom clone sequence may differ by one or more nucleotides
ATGTCTGGGAGCTTCTACTTTGTAATTGTTGGCCACCATGATAATCCAGTTTTTGAAATG
GAGTTTTTGCCAGCTGGGAAGGCAGAATCCAAAGACGACCATCGTCATCTGAACCAGTTC
ATAGCTCATGCTGCTCTCGACCTCGTAGATGAGAACATGTGGCTATCGAACAACATGTAC
TTGAAAACTGTGGACAAGTTCAACGAGTGGTTTGTGTCGGCATTTGTCACTGCGGGGCAT
ATCCTTACCTTCTTAGTAAAGGTAACTAAC
Restriction Sites Please inquire     
ACCN NM_001128835
Insert Size 2863 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001128835.1, NP_001122307.1
RefSeq Size 2863 bp
RefSeq ORF 273 bp
Locus ID 6399
UniProt ID P0DI81
Protein Families Druggable Genome, Transcription Factors
Gene Summary The protein encoded by this gene is thought to be part of a large multi-subunit complex involved in the targeting and fusion of endoplasmic reticulum-to-Golgi transport vesicles with their acceptor compartment. In addition, the encoded protein can bind c-myc promoter-binding protein 1 and block its transcriptional repression capability. Mutations in this gene are a cause of spondyloepiphyseal dysplasia tarda (SEDT). A processed pseudogene of this gene is located on chromosome 19, and other pseudogenes are found on chromosomes 8 and Y. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2010]
Transcript Variant: This variant (3) uses an alternate start codon and includes an alternate splice site in its 5' coding region, compared to variant 1. The encoded isoform (2) has a distinct and longer N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...