United States
Germany
Japan
United Kingdom
China
Neurogranin (NRGN) (NM_001126181) Human Untagged Clone
CAT＃: SC322795
NRGN (untagged)-Human neurogranin (protein kinase C substrate, RC3) (NRGN), transcript variant 2
CNY 3,990.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | hng; RC3 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC322795 representing NM_001126181.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGACTGCTGCACCGAGAACGCCTGCTCCAAGCCGGACGACGACATTCTAGACATCCCGCTGGACGAT CCCGGCGCCAACGCGGCCGCCGCCAAAATCCAGGCGAGTTTTCGGGGCCACATGGCGCGGAAGAAGATA AAGAGCGGAGAGCGCGGCCGGAAGGGCCCGGGCCCTGGGGGGCCTGGCGGAGCTGGGGTGGCCCGGGGA GGCGCGGGCGGCGGCCCCAGCGGAGACTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001126181 |
| Insert Size | 237 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001126181.1 |
| RefSeq Size | 1238 bp |
| RefSeq ORF | 237 bp |
| Locus ID | 4900 |
| UniProt ID | Q92686 |
| Protein Families | Druggable Genome |
| MW | 7.6 kDa |
| Gene Summary | Neurogranin (NRGN) is the human homolog of the neuron-specific rat RC3/neurogranin gene. This gene encodes a postsynaptic protein kinase substrate that binds calmodulin in the absence of calcium. The NRGN gene contains four exons and three introns. The exons 1 and 2 encode the protein and exons 3 and 4 contain untranslated sequences. It is suggested that the NRGN is a direct target for thyroid hormone in human brain, and that control of expression of this gene could underlay many of the consequences of hypothyroidism on mental states during development as well as in adult subjects. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) uses an alternate splice acceptor site in a 3' UTR exon. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC224996 | NRGN (Myc-DDK-tagged)-Human neurogranin (protein kinase C substrate, RC3) (NRGN), transcript variant 2 |
CNY 1,200.00 |
|
| RC224996L3 | Lenti ORF clone of Human neurogranin (protein kinase C substrate, RC3) (NRGN), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC224996L4 | Lenti ORF clone of Human neurogranin (protein kinase C substrate, RC3) (NRGN), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
| RG224996 | NRGN (tGFP-tagged) - Human neurogranin (protein kinase C substrate, RC3) (NRGN), transcript variant 2 |
CNY 4,370.00 |
其它Neurogranin产品
