United States
Germany
Japan
United Kingdom
China
ATP5MPL (NM_001127393) Human Untagged Clone
CAT＃: SC322794
C14orf2 (untagged)-Human chromosome 14 open reading frame 2 (C14orf2), transcript variant 2
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | 6.8PL; C14orf2; MLQ; MP68; PLPM |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_001127393, the custom clone sequence may differ by one or more nucleotides
ATGAAATTGTATGGAACTCGCGGGTCAGACATTTCCCATTTCCAGTGTCAGATGCTTCAA AGTATTATTAAAAACATATGGATCCCCATGAAGCCCTACTACACCAAAGTTTACCAGGAG ATTTGGATAGGAATGGGGCTGATGGGCTTCATCGTTTATAAAATCCGGGCTGCTGATAAA AGAAGTAAGGCTTTGAAAGCTTCAGCGCCTGCTCCTGGTCATCAC |
| Restriction Sites | Please inquire |
| ACCN | NM_001127393 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001127393.1, NP_001120865.1 |
| RefSeq Size | 942 bp |
| RefSeq ORF | 228 bp |
| Locus ID | 9556 |
| UniProt ID | P56378 |
| Protein Families | Transmembrane |
| Gene Summary | Mitochondrial membrane ATP synthase (F(1)F(0) ATP synthase or Complex V) produces ATP from ADP in the presence of a proton gradient across the membrane which is generated by electron transport complexes of the respiratory chain. F-type ATPases consist of two structural domains, F(1) - containing the extramembraneous catalytic core and F(0) - containing the membrane proton channel, linked together by a central stalk and a peripheral stalk. During catalysis, ATP synthesis in the catalytic domain of F(1) is coupled via a rotary mechanism of the central stalk subunits to proton translocation (Probable). Minor subunit required to maintain the ATP synthase population in the mitochondria (PubMed:24330338).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) includes an additonal exon containing an in-frame AUG upstream of the start site used in variant 1. The resulting predicted protein isoform (2) has a short distinct N-terminus compared to isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC224994 | C14orf2 (Myc-DDK-tagged)-Human chromosome 14 open reading frame 2 (C14orf2), transcript variant 2 |
CNY 3,990.00 |
|
| RC224994L3 | Lenti-ORF clone of C14orf2 (Myc-DDK-tagged)-Human chromosome 14 open reading frame 2 (C14orf2), transcript variant 2 |
CNY 5,890.00 |
|
| RC224994L4 | Lenti-ORF clone of C14orf2 (mGFP-tagged)-Human chromosome 14 open reading frame 2 (C14orf2), transcript variant 2 |
CNY 5,890.00 |
|
| RG224994 | C14orf2 (tGFP-tagged) - Human chromosome 14 open reading frame 2 (C14orf2), transcript variant 2 |
CNY 4,370.00 |
其它ATP5MPL产品
