RPL5 (NM_000969) Human Untagged Clone
CAT#: SC322784
RPL5 (untagged)-Human ribosomal protein L5 (RPL5)
CNY 2,400.00
CNY 6,270.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | L5; MSTP030; PPP1R135; uL18 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for SC322784
CCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCCGGTCTCTGTTCCGCA
GGATGGGGTTTGTTAAAGTTGTTAAGAATAAGGCCTACTTTAAGAGATACCAAGTGAAAT TTAGAAGACGACGAGAGGGTAAAACTGATTATTATGCTCGGAAACGCTTGGTGATACAAG ATAAAAATAAATACAACACACCCAAATACAGGATGATAGTTCGTGTGACAAACAGAGATA TCATTTGTCAGATTGCTTATGCCCGTATAGAGGGGGATATGATAGTCTGCGCAGCGTATG CACACGAACTGCCAAAATATGGTGTGAAGGTTGGCCTGACAAATTATGCTGCAGCATATT GTACTGGCCTGCTGCTGGCCCGCAGGCTTCTCAATAGGTTTGGCATGGACAAGATCTATG AAGGCCAAGTGGAGGTGACTGGTGATGAATACAATGTGGAAAGCATTGATGGTCAGCCAG GTGCCTTCACCTGCTATTTGGATGCAGGCCTTGCCAGAACTACCACTGGCAATAAAGTTT TTGGTGCCCTGAAGGGAGCTGTGGATGGAGGCTTGTCTATCCCTCACAGTACCAAACGAT TCCCTGGTTATGATTCTGAAAGCAAGGAATTTAATGCAGAAGTACATCGGAAGCACATCA TGGGCCAGAATGTTGCAGATTACATGCGCTGCTTAATGGAAGAAGATGAAGATGCTTACA AGAAACAGTTCTCTCAATACATAAAGAACAGCGTAACTCCAGACATGATGGAGGAGATGT ATAAGAAAGCTCATGCTGCTATACGAGAGAATCCAGTCTATGAAAAGAAGCCCAAGAAAG AAGTTAAAAAGAAGAGGTGGAACCGTCCCAAAATGTCCCTTGCTCAGAAGAAGGATCGGG TAGCTCAAAAGAAGGCAAGCTTCCTCAGAGCTCAGGAGCGGGCTGCTGAGAGCTAAACCC AGCAATTTTCTATGATTTTTTCAGATATAGATAATAAACTTATGAACAGCAAAAAAAAAA AAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_000969 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_000969.3, NP_000960.2 |
RefSeq Size | 1035 bp |
RefSeq ORF | 894 bp |
Locus ID | 6125 |
UniProt ID | P46777 |
Domains | Ribosomal_L18p |
Protein Pathways | Ribosome |
Gene Summary | Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of four RNA species and approximately 80 structurally distinct proteins. This gene encodes a member of the L18P family of ribosomal proteins and component of the 60S subunit. The encoded protein binds 5S rRNA to form a stable complex called the 5S ribonucleoprotein particle (RNP), which is necessary for the transport of nonribosome-associated cytoplasmic 5S rRNA to the nucleolus for assembly into ribosomes. The encoded protein may also function to inhibit tumorigenesis through the activation of downstream tumor suppressors and the downregulation of oncoprotein expression. Mutations in this gene have been identified in patients with Diamond-Blackfan Anemia (DBA). This gene is co-transcribed with the small nucleolar RNA gene U21, which is located in its fifth intron. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed throughout the genome. [provided by RefSeq, Mar 2017] Transcript Variant: This variant (1) represents the longer transcript and encodes the supported protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC210734 | RPL5 (Myc-DDK-tagged)-Human ribosomal protein L5 (RPL5) |
CNY 2,400.00 |
|
RC210734L1 | Lenti ORF clone of Human ribosomal protein L5 (RPL5), Myc-DDK-tagged |
CNY 4,800.00 |
|
RC210734L2 | Lenti ORF clone of Human ribosomal protein L5 (RPL5), mGFP tagged |
CNY 5,890.00 |
|
RC210734L3 | Lenti ORF clone of Human ribosomal protein L5 (RPL5), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC210734L4 | Lenti ORF clone of Human ribosomal protein L5 (RPL5), mGFP tagged |
CNY 5,890.00 |
|
RG210734 | RPL5 (tGFP-tagged) - Human ribosomal protein L5 (RPL5) |
CNY 4,000.00 |
|
SC119571 | RPL5 (untagged)-Human ribosomal protein L5 (RPL5) |
CNY 2,400.00 |