NKG2D (KLRK1) (NM_007360) Human Untagged Clone
CAT#: SC322611
KLRK1 (untagged)-Human killer cell lectin-like receptor subfamily K, member 1 (KLRK1)
CNY 2,400.00
CNY 2,950.00
Cited in 1 publication. |
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CD314; D12S2489E; KLR; NKG2-D; NKG2D |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for SC322611
TGAGGACATATCTAAATTTTCTAGTTTTATAGAAGGCTTTTATCCACAAGAATCAAGATC
TTCCCTCTCTGAGCAGGAATCCTTTGTGCATTGAAGACTTTAGATTCCTCTCTGCGGTAG ACGTGCACTTATAAGTATTTGATGGGGTGGATTCGTGGTCGGAGGTCTCGACACAGCTGG GAGATGAGTGAATTTCATAATTATAACTTGGATCTGAAGAAGAGTGATTTTTCAACACGA TGGCAAAAGCAAAGATGTCCAGTAGTCAAAAGCAAATGTAGAGAAAATGCATCTCCATTT TTTTTCTGCTGCTTCATCGCTGTAGCCATGGGAATCCGTTTCATTATTATGGTAGCAATA TGGAGTGCTGTATTCCTAAACTCATTATTCAACCAAGAAGTTCAAATTCCCTTGACCGAA AGTTACTGTGGCCCATGTCCTAAAAACTGGATATGTTACAAAAATAACTGCTACCAATTT TTTGATGAGAGTAAAAACTGGTATGAGAGCCAGGCTTCTTGTATGTCTCAAAATGCCAGC CTTCTGAAAGTATACAGCAAAGAGGACCAGGATTTACTTAAACTGGTGAAGTCATATCAT TGGATGGGACTAGTACACATTCCAACAAATGGATCTTGGCAGTGGGAAGATGGCTCCATT CTCTCACCCAACCTACTAACAATAATTGAAATGCAGAAGGGAGACTGTGCACTCTATGCC TCGAGCTTTAAAGGCTATATAGAAAACTGTTCAACTCCAAATACATACATCTGCATGCAA AGGACTGTGTAAAGATGATCAACCATCTCAATAAAAGCCAGGAACAGAGAAGAGATTACA CCAGCGGTAACACTGCCAACCGAGACTAAAGGAAACAAACAAAAACAGGACAAAATGACC AAAGACTGTCAGATTTCTTAGACTCCACAGGACCAAACCATAGAACAATTTCACTGCAAA CATGCATGATTCTCCAAGACAAAAGAAGAGAGATCCTAAAGGCAATTCAGATATCCCCAA GGCTGCCTCTCCCACCACAAGCCCAGAGTGGATGGGCTGGGGGAGGGGTGCTGTTTTAAT TTCTAAAGGTAGGACCAACACCCAGGGGATCAGTGAAGGAAGAGAAGGCCAGCAGATCAG TGAGAGTGCAACCCCACCCTCCACAGGAAATTGCCTCATGGGCAGGGCCACAGCAGAGAG ACACAGCATGGGCAGTGCCTTCCCTGCCTGTGGGGGTCATGCTGCCACTTTTAATGGGTC CTCCACCCAACGGGGTCAGGGAGGTGGTGCTGCCCTAGTGGGCCATGATTATCTTAAAGG CATTATTCTCCAGCCTTAAGATCTTAGGACGTTTCCTTTGCTATGATTTGTACTTGCTTG AGTCCCATGACTGTTTCTCTTCCTCTCTTTCTTCCTTTTGGAATAGTAATATCCATCCTA TGTTTGTCCCACTATTGTATTTTGGAAGCACATAACTTGTTTGGTTTCACAGGTTCACAG TTAAGAAGGAATTTTGCCTCTGAATAAATAGAATCTTGAGTCTCATGCAAAAAAAAAAAA AAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_007360 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_007360.1, NP_031386.1 |
RefSeq Size | 1770 bp |
RefSeq ORF | 651 bp |
Locus ID | 22914 |
UniProt ID | P26718 |
Domains | CLECT |
Protein Families | Transmembrane |
Protein Pathways | Natural killer cell mediated cytotoxicity |
Gene Summary | Natural killer (NK) cells are lymphocytes that can mediate lysis of certain tumor cells and virus-infected cells without previous activation. They can also regulate specific humoral and cell-mediated immunity. NK cells preferentially express several calcium-dependent (C-type) lectins, which have been implicated in the regulation of NK cell function. The NKG2 gene family is located within the NK complex, a region that contains several C-type lectin genes preferentially expressed in NK cells. This gene encodes a member of the NKG2 family. The encoded transmembrane protein is characterized by a type II membrane orientation (has an extracellular C terminus) and the presence of a C-type lectin domain. It binds to a diverse family of ligands that include MHC class I chain-related A and B proteins and UL-16 binding proteins, where ligand-receptor interactions can result in the activation of NK and T cells. The surface expression of these ligands is important for the recognition of stressed cells by the immune system, and thus this protein and its ligands are therapeutic targets for the treatment of immune diseases and cancers. Read-through transcription exists between this gene and the upstream KLRC4 (killer cell lectin-like receptor subfamily C, member 4) family member in the same cluster. [provided by RefSeq, Dec 2010] |
Citations (1)
The use of this cDNA Clones has been cited in the following citations: |
---|
A Thr72Ala polymorphism in the NKG2D gene is associated with early symptomatic congenital cytomegalovirus disease
,Taniguchi, R;Koyano, S;Suzutani, T;Goishi, K;Ito, Y;Morioka, I;Nakamura, H;Yamada, H;Oka, A;Inoue, N;,
Infection
,PubMed ID 25861030
[KLRK1]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC208050 | KLRK1 (Myc-DDK-tagged)-Human killer cell lectin-like receptor subfamily K, member 1 (KLRK1) |
CNY 2,400.00 |
|
RC208050L1 | Lenti ORF clone of Human killer cell lectin-like receptor subfamily K, member 1 (KLRK1), Myc-DDK-tagged |
CNY 4,800.00 |
|
RC208050L2 | Lenti ORF clone of Human killer cell lectin-like receptor subfamily K, member 1 (KLRK1), mGFP tagged |
CNY 5,890.00 |
|
RC208050L3 | Lenti ORF clone of Human killer cell lectin-like receptor subfamily K, member 1 (KLRK1), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC208050L4 | Lenti ORF clone of Human killer cell lectin-like receptor subfamily K, member 1 (KLRK1), mGFP tagged |
CNY 4,800.00 |
|
RG208050 | KLRK1 (tGFP-tagged) - Human killer cell lectin-like receptor subfamily K, member 1 (KLRK1) |
CNY 4,000.00 |
|
SC115560 | KLRK1 (untagged)-Human killer cell lectin-like receptor subfamily K, member 1 (KLRK1) |
CNY 2,400.00 |