emopamil binding protein (EBP) (NM_006579) Human Untagged Clone
CAT#: SC322500
EBP (untagged)-Human emopamil binding protein (sterol isomerase) (EBP)
CNY 2,400.00
CNY 2,950.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CDPX2; CHO2; CPX; CPXD; MEND |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for SC322500
GCGAGACCCAGCCTAAAGAGAGCCCGGAGCCAGCGTGGGAGGCCGCTGCCGTCGCGCGCC
TTGGTTTTTCTGTTCCTTTTTTTTTTTTTTTTTTTAACTTCCTGCCTATACACACGCAGC CATCAGCCCACAAAGACATGACTACCAACGCGGGCCCCTTGCACCCATACTGGCCTCAGC ACCTAAGACTGGACAACTTTGTACCTAATGACCGCCCCACCTGGCATATACTGGCTGGCC TCTTCTCTGTCACAGGGGTCTTAGTCGTGACCACATGGCTGTTGTCAGGTCGTGCTGCGG TTGTCCCATTGGGGACTTGGCGGCGACTGTCCCTGTGCTGGTTTGCAGTGTGTGGGTTCA TTCACCTGGTGATCGAGGGCTGGTTCGTTCTCTACTACGAAGACCTGCTTGGAGACCAAG CCTTCTTATCTCAACTCTGGAAAGAGTATGCCAAGGGAGACAGCCGATACATCCTGGGTG ACAACTTCACAGTGTGCATGGAAACCATCACAGCTTGCCTGTGGGGACCACTCAGCCTGT GGGTGGTGATCGCCTTTCTCCGCCAGCATCCCCTCCGCTTCATTCTACAGCTTGTGGTCT CTGTGGGCCAGATCTATGGGGATGTGCTCTACTTCCTGACAGAGCACCGCGACGGATTCC AGCACGGAGAGCTGGGCCACCCTCTCTACTTCTGGTTTTACTTTGTCTTCATGAATGCCC TGTGGCTGGTGCTGCCTGGAGTCCTTGTGCTTGATGCTGTGAAGCACCTCACTCATGCCC AGAGCACGCTGGATGCCAAGGCCACAAAAGCCAAGAGCAAGAAGAACTGAGGAGTGGTGG ACCAGGCTCGAACACTGGCCGAGGAGGAGCTCTCTGCCTGCCAGAAGAGTCTAGTCCTGC TCCCACAGTTTGGAGGGACAAAGCTAATTGATCTGTCACACTCAGGCTCATGGGCAGGCA CAAGAAGGGGAATAAAGGGGCTGTGTGAAGGCACTGCTGGGAGCCATTAGAACACAGATA CAAGAGAAGCCAGGAGGTCTATGATGGTGACGATTTTTAAAATCAGGAAATAAAAGATCT TGACTCTAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_006579 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_006579.1, NP_006570.1 |
RefSeq Size | 1073 bp |
RefSeq ORF | 693 bp |
Locus ID | 10682 |
UniProt ID | Q15125 |
Protein Families | Druggable Genome, Transmembrane |
Protein Pathways | Metabolic pathways, Steroid biosynthesis |
Gene Summary | The protein encoded by this gene is an integral membrane protein of the endoplasmic reticulum. It is a high affinity binding protein for the antiischemic phenylalkylamine Ca2+ antagonist [3H]emopamil and the photoaffinity label [3H]azidopamil. It is similar to sigma receptors and may be a member of a superfamily of high affinity drug-binding proteins in the endoplasmic reticulum of different tissues. This protein shares structural features with bacterial and eukaryontic drug transporting proteins. It has four putative transmembrane segments and contains two conserved glutamate residues which may be involved in the transport of cationic amphiphilics. Another prominent feature of this protein is its high content of aromatic amino acid residues (>23%) in its transmembrane segments. These aromatic amino acid residues have been suggested to be involved in the drug transport by the P-glycoprotein. Mutations in this gene cause Chondrodysplasia punctata 2 (CDPX2; also known as Conradi-Hunermann syndrome). [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC201706 | EBP (Myc-DDK-tagged)-Human emopamil binding protein (sterol isomerase) (EBP) |
CNY 2,400.00 |
|
RC201706L1 | Lenti ORF clone of Human emopamil binding protein (sterol isomerase) (EBP), Myc-DDK-tagged |
CNY 4,800.00 |
|
RC201706L2 | Lenti ORF clone of Human emopamil binding protein (sterol isomerase) (EBP), mGFP tagged |
CNY 5,890.00 |
|
RC201706L3 | Lenti ORF clone of Human emopamil binding protein (sterol isomerase) (EBP), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC201706L4 | Lenti ORF clone of Human emopamil binding protein (sterol isomerase) (EBP), mGFP tagged |
CNY 5,890.00 |
|
RG201706 | EBP (tGFP-tagged) - Human emopamil binding protein (sterol isomerase) (EBP) |
CNY 4,000.00 |
|
SC116006 | EBP (untagged)-Human emopamil binding protein (sterol isomerase) (EBP) |
CNY 2,400.00 |
其它emopamil binding protein产品