IL11 (NM_000641) Human Untagged Clone
CAT#: SC322493
IL11 (untagged)-Human interleukin 11 (IL11)
CNY 2,400.00
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | AGIF; IL-11 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for SC322493
GCTCAGGGCACATGCCTCCCCTCCCCAGGCCGCGGCCCAGCTGACCCTCGGGGCTCCCCC
GGCAGCGGACAGGGAAGGGTTAAAGGCCCCCGGCTCCCTGCCCCCTGCCCTGGGGAACCC CTGGCCCTGTGGGGACATGAACTGTGTTTGCCGCCTGGTCCTGGTCGTGCTGAGCCTGTG GCCAGATACAGCTGTCGCCCCTGGGCCACCACCTGGCCCCCCTCGAGTTTCCCCAGACCC TCGGGCCGAGCTGGACAGCACCGTGCTCCTGACCCGCTCTCTCCTGGCGGACACGCGGCA GCTGGCTGCACAGCTGAGGGACAAATTCCCAGCTGACGGGGACCACAACCTGGATTCCCT GCCCACCCTGGCCATGAGTGCGGGGGCACTGGGAGCTCTACAGCTCCCAGGTGTGCTGAC AAGGCTGCGAGCGGACCTACTGTCCTACCTGCGGCACGTGCAGTGGCTGCGCCGGGCAGG TGGCTCTTCCCTGAAGACCCTGGAGCCCGAGCTGGGCACCCTGCAGGCCCGACTGGACCG GCTGCTGCGCCGGCTGCAGCTCCTGATGTCCCGCCTGGCCCTGCCCCAGCCACCCCCGGA CCCGCCGGCGCCCCCGCTGGCGCCCCCCTCCTCAGCCTGGGGGGGCATCAGGGCCGCCCT CGCCATCCTGGGGGGGCTGCACCTGACACTTGACTGGGCCGTGAGGGGACTGCTGCTGCT GAAGACTCGGCTGTGACCCGGGGCCCAAAGCCACCACCGTCCTTCCAAAGCCAGATCTTA TTTATTTATTTATTTCAGTACTGGGGGCGAAACAGCCAGGTGATCCCCCCGCCATTATCT CCCCCTAGTTAGAGACAGTCCTTCCGTGAGGCCTGGGGGACATCTGTGCCTTATTTATAC TTATTTATTTCAGGAGCAGGGGTGGGAGGCAGGTGGACTCCTGGGTCCCCGAGGAGGAGG GGACTGGGGTCCCGGATTCTTGGGTCTCCAAGAAGTCTGTCCACAGACTTCTGCCCTGGC TCTTCCCCATCTAGGCCTGGGCAGGAACATATATTATTTATTTAAGCAATTACTTTTCAT GTTGGGGTGGGGACGGAGGGGAAAGGGAAGCCTGGGTTTTTGTACAAAAATGTGAGAAAC CTTTGTGAGACAGAGAACAGGGAATTAAATGTGTCATACATATCCAAAAAAAAAAAAAAA A |
Restriction Sites | Please inquire |
ACCN | NM_000641 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_000641.2, NP_000632.1 |
RefSeq Size | 2354 bp |
RefSeq ORF | 600 bp |
Locus ID | 3589 |
UniProt ID | P20809 |
Protein Families | Druggable Genome, Secreted Protein |
Protein Pathways | Cytokine-cytokine receptor interaction, Hematopoietic cell lineage, Jak-STAT signaling pathway |
Gene Summary | The protein encoded by this gene is a member of the gp130 family of cytokines. These cytokines drive the assembly of multisubunit receptor complexes, all of which contain at least one molecule of the transmembrane signaling receptor IL6ST (gp130). This cytokine is shown to stimulate the T-cell-dependent development of immunoglobulin-producing B cells. It is also found to support the proliferation of hematopoietic stem cells and megakaryocyte progenitor cells. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jun 2012] Transcript Variant: This variant (1) is the longer transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC204493 | IL11 (Myc-DDK-tagged)-Human interleukin 11 (IL11) |
CNY 2,400.00 |
|
RC204493L1 | Lenti ORF clone of Human interleukin 11 (IL11), Myc-DDK-tagged |
CNY 4,800.00 |
|
RC204493L2 | Lenti ORF clone of Human interleukin 11 (IL11), mGFP tagged |
CNY 4,800.00 |
|
RC204493L3 | Lenti ORF clone of Human interleukin 11 (IL11), Myc-DDK-tagged |
CNY 4,800.00 |
|
RC204493L4 | Lenti ORF clone of Human interleukin 11 (IL11), mGFP tagged |
CNY 4,800.00 |
|
RG204493 | IL11 (tGFP-tagged) - Human interleukin 11 (IL11) |
CNY 4,000.00 |