Endothelin 1 (EDN1) (NM_001955) Human Untagged Clone
CAT#: SC322339
EDN1 (untagged)-Human endothelin 1 (EDN1), transcript variant 1
CNY 3,600.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ARCND3; ET1; HDLCQ7; PPET1; QME |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for SC322339
CGCCGCGTGCGCCTGCAGACGCTCCGCTCGCTGCCTTCTCTCCTGGCAGGCGCTGCCTTT
TCTCCCCGTTAAAGGGCACTTGGGCTGAAGGATCGCTTTGAGATCTGAGGAACCCGCAGC GCTTTGAGGGACCTGAAGCTGTTTTTCTTCGTTTTCCTTTGGGTTCAGTTTGAACGGGAG GTTTTTGATCCCTTTTTTTCAGAATGGATTATTTGCTCATGATTTTCTCTCTGCTGTTTG TGGCTTGCCAAGGAGCTCCAGAAACAGCAGTCTTAGGCGCTGAGCTCAGCGCGGTGGGTG AGAACGGCGGGGAGAAACCCACTCCCAGTCCACCCTGGCGGCTCCGCCGGTCCAAGCGCT GCTCCTGCTCGTCCCTGATGGATAAAGAGTGTGTCTACTTCTGCCACCTGGACATCATTT GGGTCAACACTCCCGAGCACGTTGTTCCGTATGGACTTGGAAGCCCTAGGTCCAAGAGAG CCTTGGAGAATTTACTTCCCACAAAGGCAACAGACCGTGAGAATAGATGCCAATGTGCTA GCCAAAAAGACAAGAAGTGCTGGAATTTTTGCCAAGCAGGAAAAGAACTCAGGGCTGAAG ACATTATGGAGAAAGACTGGAATAATCATAAGAAAGGAAAAGACTGTTCCAAGCTTGGGA AAAAGTGTATTTATCAGCAGTTAGTGAGAGGAAGAAAAATCAGAAGAAGTTCAGAGGAAC ACCTAAGACAAACCAGGTCGGAGACCATGAGAAACAGCGTCAAATCATCTTTTCATGATC CCAAGCTGAAAGGCAATCCCTCCAGAGAGCGTTATGTGACCCACAACCGAGCACATTGGT GACAGACCTTCGGGGCCTGTCTGAAGCCATAGCCTCCACGGAGAGCCCTGTGGCCGACTC TGCACTCTCCACCCTGGCTGGGATCAGAGCAGGAGCATCCTCTGCTGGTTCCTGACTGGC AAAGGACCAGCGTCCTCGTTCAAAACATTCCAAGAAAGGTTAAGGAGTTCCCCCAACCAT CTTCACTGGCTTCCATCAGTGGTAACTGCTTTGGTCTCTTCTTTCATCTGGGGATGACAA TGGACCTCTCAGCAGAAACACACAGTCACATTCGAATTCGGGTGGCATCCTCCGGAGAGA GAGAGAGGAAGGAGATTCCACACAGGGGTGGAGTTTCTGACGAAGGTCCTAAGGGAGTGT TTGTGTCTGACTCAGGCGCCTGGCACATTTCAGGGAGAAACTCCAAAGTCCACACAAAGA TTTTCTAAGGAATGCACAAATTGAAAACACACTCAAAAGACAAACATGCAAGTAAAGAAA AAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_001955 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001955.2, NP_001946.2 |
RefSeq Size | 1334 bp |
RefSeq ORF | 639 bp |
Locus ID | 1906 |
UniProt ID | P05305 |
Domains | END |
Protein Families | Druggable Genome, Secreted Protein |
Protein Pathways | Melanogenesis |
Gene Summary | This gene encodes a preproprotein that is proteolytically processed to generate a secreted peptide that belongs to the endothelin/sarafotoxin family. This peptide is a potent vasoconstrictor and its cognate receptors are therapeutic targets in the treatment of pulmonary arterial hypertension. Aberrant expression of this gene may promote tumorigenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2015] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC202217 | EDN1 (Myc-DDK-tagged)-Human endothelin 1 (EDN1), transcript variant 1 |
CNY 3,600.00 |
|
RC202217L1 | Lenti ORF clone of Human endothelin 1 (EDN1), transcript variant 1, Myc-DDK-tagged |
CNY 6,000.00 |
|
RC202217L2 | Lenti ORF clone of Human endothelin 1 (EDN1), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RC202217L3 | Lenti ORF clone of Human endothelin 1 (EDN1), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC202217L4 | Lenti ORF clone of Human endothelin 1 (EDN1), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RG202217 | EDN1 (tGFP-tagged) - Human endothelin 1 (EDN1), transcript variant 1 |
CNY 5,200.00 |
|
SC118900 | EDN1 (untagged)-Human endothelin 1 (EDN1), transcript variant 1 |
CNY 3,600.00 |
其它Endothelin 1产品