CIB1 (NM_006384) Human Untagged Clone
CAT#: SC322192
CIB1 (untagged)-Human calcium and integrin binding 1 (calmyrin) (CIB1)
CNY 2,400.00
CNY 2,950.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CIB; CIBP; KIP1; PRKDCIP; SIP2-28 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for SC322192
CCGCTCGAGGCGAGTTGGCGGAGCTGTGCGCGCGGCGGGGCGATGGGGGGCTCGGGCAGT
CGCCTGTCCAAGGAGCTGCTGGCCGAGTACCAGGACTTGACGTTCCTGACGAAGCAGGAG ATCCTCCTAGCCCACAGGCGGTTTTGTGAGCTGCTTCCCCAGGAGCAGCGGAGCGTGGAG TCGTCACTTCGGGCACAAGTGCCCTTCGAGCAGATTCTCAGCCTTCCAGAGCTCAAGGCC AACCCCTTCAAGGAGCGAATCTGCAGGGTCTTCTCCACATCCCCAGCCAAAGACAGCCTT AGCTTTGAGGACTTCCTGGATCTCCTCAGTGTGTTCAGTGACACAGCCACGCCAGACATC AAGTCCCATTATGCCTTCCGCATCTTTGACTTTGATGATGACGGAACCTTGAACAGAGAA GACCTGAGCCGGCTGGTGAACTGCCTCACGGGAGAGGGCGAGGACACACGGCTTAGTGCG TCTGAGATGAAGCAGCTCATCGACAACATCCTGGAGGAGTCTGACATTGACAGGGATGGA ACCATCAACCTCTCTGAGTTCCAGCACGTCATCTCCCGTTCTCCAGACTTTGCCAGCTCC TTTAAGATTGTCCTGTGACAGCAGCCCCAGCGTGTGTCCTGGCACCCTGTCCAAGAACCT TTCTACTGCTGAGCTGTGGCCAAGGTCAAGCCTGTGTTGCCAGTGCGGGCCAAGCTGGCC CAGCCTGGAGCTGGCGCTGTGCAGCCTCACCCCGGGCAGGGGCGGCCCTCGTTGTCAGGG CCTCTCCTCACTGCTGTTGTCATTGCTCCGTTTGTGTTTGTACTAATCAGTAATAAAGGT TTAGAAGTTTGAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_006384 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_006384.2, NP_006375.1 |
RefSeq Size | 905 bp |
RefSeq ORF | 576 bp |
Locus ID | 10519 |
UniProt ID | Q99828 |
Domains | EFh |
Gene Summary | This gene encodes a member of the EF-hand domain-containing calcium-binding superfamily. The encoded protein interacts with many other proteins, including the platelet integrin alpha-IIb-beta-3, DNA-dependent protein kinase, presenilin-2, focal adhesion kinase, p21 activated kinase, and protein kinase D. The encoded protein may be involved in cell survival and proliferation, and is associated with several disease states including cancer and Alzheimer's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2013] Transcript Variant: This variant (b) uses an alternate splice site in the coding region, compared to variant a. The encoded isoform (b, also known as CIB1) is shorter, compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC201591 | CIB1 (Myc-DDK-tagged)-Human calcium and integrin binding 1 (calmyrin) (CIB1) |
CNY 2,400.00 |
|
RC201591L1 | Lenti ORF clone of Human calcium and integrin binding 1 (calmyrin) (CIB1), Myc-DDK-tagged |
CNY 4,800.00 |
|
RC201591L2 | Lenti ORF clone of Human calcium and integrin binding 1 (calmyrin) (CIB1), mGFP tagged |
CNY 5,890.00 |
|
RC201591L3 | Lenti ORF clone of Human calcium and integrin binding 1 (calmyrin) (CIB1), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC201591L4 | Lenti ORF clone of Human calcium and integrin binding 1 (calmyrin) (CIB1), mGFP tagged |
CNY 4,800.00 |
|
RG201591 | CIB1 (tGFP-tagged) - Human calcium and integrin binding 1 (calmyrin) (CIB1) |
CNY 4,000.00 |
|
SC116165 | CIB1 (untagged)-Human calcium and integrin binding 1 (calmyrin) (CIB1) |
CNY 2,400.00 |