CSRP2 (NM_001321) Human Untagged Clone
CAT#: SC322165
CSRP2 (untagged)-Human cysteine and glycine-rich protein 2 (CSRP2)
CNY 2,400.00
CNY 2,950.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CRP2; LMO5; SmLIM |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for SC322165
GCCCAGCCTCGCTAGCTCCGCCTGCGGTACGTGCTCCCGCCTCCGACTCAAAATGCCTGT
CTGGGGAGGTGGAAACAAGTGTGGGGCCTGTGGGAGGACCGTGTACCACGCAGAAGAGGT GCAGTGTGATGGCAGGAGCTTCCACCGCTGCTGCTTTCTCTGCATGGTTTGCAGGAAAAA TTTAGATAGCACAACAGTGGCAATTCACGATGAAGAGATCTACTGCAAATCCTGCTACGG AAAGAAGTATGGGCCAAAAGGCTACGGTTATGGCCAGGGCGCTGGCACGCTTAACATGGA CCGTGGCGAGAGGCTGGGCATCAAACCAGAGAGTGTTCAGCCTCACAGGCCTACAACAAA TCCAAACACTTCTAAATTTGCTCAGAAATATGGAGGTGCTGAGAAGTGTTCCAGATGTGG GGATTCTGTATATGCTGCCGAGAAGATAATTGGAGCTGGAAAGCCCTGGCACAAAAACTG TTTCCGATGTGCAAAGTGTGGGAAGAGTCTTGAATCAACAACTCTGACTGAAAAAGAAGG TGAAATCTATTGTAAAGGATGCTATGCAAAGAACTTTGGGCCCAAGGGATTTGGCTATGG CCAAGGAGCAGGGGCTCTTGTTCATGCCCAGTAAGATGTAAACCCTGAACTAAACATCAC ACACTGAGAATCTCTTCATAATCTAGGCACAGATAATCTTTAACACTAAACTACTGTGAA ATTCTACCAGCATTAAGTACTGTATATCGCCCTGTACTTGGATAGGCTGGCTAACTCGTA GGAAGAGAGCACTGTATGGTATCCTTTTGCTTTATTCACCAGCATTTTGGGGGAACATTT CTTTTACATTTTAAATAAAACTTCAGCTTGAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_001321 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001321.1, NP_001312.1 |
RefSeq Size | 901 bp |
RefSeq ORF | 582 bp |
Locus ID | 1466 |
UniProt ID | Q16527 |
Domains | LIM |
Gene Summary | CSRP2 is a member of the CSRP family of genes, encoding a group of LIM domain proteins, which may be involved in regulatory processes important for development and cellular differentiation. CRP2 contains two copies of the cysteine-rich amino acid sequence motif (LIM) with putative zinc-binding activity, and may be involved in regulating ordered cell growth. Other genes in the family include CSRP1 and CSRP3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014] Transcript Variant: This variant (1) represents the longer transcript. Variants 1 and 2 encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC201565 | CSRP2 (Myc-DDK-tagged)-Human cysteine and glycine-rich protein 2 (CSRP2) |
CNY 2,400.00 |
|
RC201565L1 | Lenti ORF clone of Human cysteine and glycine-rich protein 2 (CSRP2), Myc-DDK-tagged |
CNY 4,800.00 |
|
RC201565L2 | Lenti ORF clone of Human cysteine and glycine-rich protein 2 (CSRP2), mGFP tagged |
CNY 5,890.00 |
|
RC201565L3 | Lenti ORF clone of Human cysteine and glycine-rich protein 2 (CSRP2), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC201565L4 | Lenti ORF clone of Human cysteine and glycine-rich protein 2 (CSRP2), mGFP tagged |
CNY 5,890.00 |
|
RG201565 | CSRP2 (tGFP-tagged) - Human cysteine and glycine-rich protein 2 (CSRP2) |
CNY 4,000.00 |
|
SC119303 | CSRP2 (untagged)-Human cysteine and glycine-rich protein 2 (CSRP2) |
CNY 2,400.00 |