United States
Germany
Japan
United Kingdom
China
Ribosomal protein L26 (RPL26) (NM_000987) Human Untagged Clone
CAT＃: SC321975
RPL26 (untagged)-Human ribosomal protein L26 (RPL26)
CNY 1,200.00
CNY 3,990.00
Product images
热销推荐Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | DBA11; L26 |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for SC321975
TGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTTTGTGACTTCCGA
CCGAAGCAAGAATCGCAAAAGGCATTTCAATGCACCTTCCCACATTCGAAGGAAGATTAT GTCTTCCCCTCTTTCCAAAGAGCTGAGACAGAAGTACAACGTGCGATCCATGCCCATCCG AAAGGATGATGAAGTTCAGGTTGTACGTGGACACTATAAAGGTCAGCAAATTGGCAAAGT AGTCCAGGTTTACAGGAAGAAATATGTTATCTACATTGAACGGGTGCAGCGGGAAAAGGC TAATGGCACAACTGTCCACGTAGGCATTCACCCCAGCAAGGTGGTTATCACTAGGCTAAA ACTGGACAAAGACCGCAAAAAGATCCTCGAACGGAAAGCCAAATCTCGCCAAGTAGGAAA GGAAAAGGGCAAATACAAGGAAGAAACCATTGAGAAGATGCAGGAATAAAGTAATCTTAT ATACAAGCTTTGATTAAAACTTGAAACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_000987 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_000987.3, NP_000978.1 |
| RefSeq Size | 602 bp |
| RefSeq ORF | 438 bp |
| Locus ID | 6154 |
| UniProt ID | P61254 |
| Domains | KOW, KOW |
| Protein Pathways | Ribosome |
| Gene Summary | Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L24P family of ribosomal proteins. It is located in the cytoplasm. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. Mutations in this gene result in Diamond-Blackfan anemia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2015] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1, 2 and 3 encode the same protein. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC209922 | RPL26 (Myc-DDK-tagged)-Human ribosomal protein L26 (RPL26) |
CNY 1,200.00 |
|
| RC209922L1 | Lenti ORF clone of Human ribosomal protein L26 (RPL26), Myc-DDK-tagged |
CNY 3,600.00 |
|
| RC209922L2 | Lenti ORF clone of Human ribosomal protein L26 (RPL26), mGFP tagged |
CNY 5,890.00 |
|
| RC209922L3 | Lenti ORF clone of Human ribosomal protein L26 (RPL26), Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC209922L4 | Lenti ORF clone of Human ribosomal protein L26 (RPL26), mGFP tagged |
CNY 5,890.00 |
|
| RG209922 | RPL26 (tGFP-tagged) - Human ribosomal protein L26 (RPL26) |
CNY 2,800.00 |
|
| SC119493 | RPL26 (untagged)-Human ribosomal protein L26 (RPL26) |
CNY 1,200.00 |
其它Ribosomal protein L26产品
