MSRB3 (NM_001031679) Human Untagged Clone
CAT#: SC321838
MSRB3 (untagged)-Human methionine sulfoxide reductase B3 (MSRB3), nuclear gene encoding mitochondrial protein, transcript variant 2
CNY 2,400.00
CNY 3,990.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | DFNB74 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_001031679.1
CACCGGCGGCGGCTGCCTGGCCTTTCCATGAGCCCGCGGCGGACCCTCCCGCGCCCCCTC
TCGCTCTGCCTCTCCCTCTGCCTCTGCCTCTGCCTGGCCGCGGCTCTGGGAAGTGCGCAG TCCGAGTGACATCACTGCCTCTCTTCCTGTGCGCTGGCTTTGACATAAGCCAGATGGCCA CCGTGGTTGGTAGGCGCCCAGGCTGCCTGGTACAGGAGTTGATGAAACAGAATAGGAAGA CGTTTTATGGTCAGCTGTGGAAGCACAGTGAGACTGCAGCTTTGCTAACTCTTGCCCCTG TTCTTTGCTTCTCGTTTTGTTGGTGAAGATATCACAGTGATGTCTGCATTCAACCTGCTG CATTTGGTGACAAAGAGCCAGCCAGTAGCCCTTCGAGCCTGTGGGCTTCCCTCAGGGTCG TGTAGGGATAAAAAGAACTGTAAGGTGGTCTTTTCCCAGCAGGAACTGAGGAAGCGGCTA ACACCCCTGCAGTACCATGTCACTCAGGAGAAAGGGACCGAAAGTGCCTTTGAAGGAGAA TACACACATCACAAAGATCCTGGAATATATAAATGTGTTGTTTGTGGAACTCCATTGTTT AAGTCAGAAACCAAATTTGACTCCGGTTCAGGTTGGCCTTCATTCCACGATGTGATCAAT TCTGAGGCAATCACATTCACAGATGACTTTTCCTATGGGATGCACAGGGTGGAAACAAGC TGCTCTCAGTGTGGTGCTCACCTTGGGCACATTTTTGATGATGGGCCTCGTCCAACTGGG AAAAGATACTGCATAAATTCGGCTGCCTTGTCTTTTACACCTGCGGATAGCAGTGGCACC GCCGAGGGAGGCAGTGGGGTCGCCAGCCCGGCCCAGGCAGACAAAGCGGAGCTCTAGAGT AATGGAGAGTGATGGAAACAAAGTGTACTTAATGCACAGCTTATTAAAAAAATCAAAATT GTTAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_001031679 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001031679.1, NP_001026849.1 |
RefSeq Size | 4369 bp |
RefSeq ORF | 558 bp |
Locus ID | 253827 |
UniProt ID | Q8IXL7 |
Gene Summary | The protein encoded by this gene catalyzes the reduction of methionine sulfoxide to methionine. This enzyme acts as a monomer and requires zinc as a cofactor. Several transcript variants encoding two different isoforms have been found for this gene. One of the isoforms localizes to mitochondria while the other localizes to endoplasmic reticula. [provided by RefSeq, Jul 2010] Transcript Variant: This variant (2) differs in the 5' UTR and coding sequence compared to variant 1. The resulting isoform (2) has a shorter and distinct N-terminus compared to isoform 1. Variants 2, 3, and 4 all encode isoform 2. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC208187 | MSRB3 (Myc-DDK-tagged)-Human methionine sulfoxide reductase B3 (MSRB3), nuclear gene encoding mitochondrial protein, transcript variant 2 |
CNY 2,400.00 |
|
RC208187L3 | Lenti ORF clone of Human methionine sulfoxide reductase B3 (MSRB3), nuclear gene encoding mitochondrial protein, transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC208187L4 | Lenti ORF clone of Human methionine sulfoxide reductase B3 (MSRB3), nuclear gene encoding mitochondrial protein, transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG208187 | MSRB3 (tGFP-tagged) - Human methionine sulfoxide reductase B3 (MSRB3), nuclear gene encoding mitochondrial protein, transcript variant 2 |
CNY 4,000.00 |