United States
Germany
Japan
United Kingdom
China
TMEM126B (NM_018480) Human Untagged Clone
CAT＃: SC321745
TMEM126B (untagged)-Human transmembrane protein 126B (TMEM126B), transcript variant 1
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | HT007; MC1DN29 |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>NCBI ORF sequence for NM_018480, the custom clone sequence may differ by one or more nucleotides
ATGGTGGTGTTCGGGTATGAGGCTGGGACTAAGCCAAGGGATTCAGGTGTGGTGCCGGTGGGAACTGAGG AAGCGCCCAAGGTTTTCAAGATGGCAGCATCTATGCATGGTCAGCCCAGTCCTTCTCTAGAAGATGCAAA ACTCAGAAGACCAATGGTCATAGAAATCATAGAAAAAAATTTTGACTATCTTAGAAAAGAAATGACACAA AATATATATCAAATGGCGACATTTGGAACAACAGCTGGTTTCTCTGGAATATTCTCAAACTTCCTGTTCA GACGCTGCTTCAAGGTTAAACATGATGCTTTGAAGACATATGCATCATTGGCTACACTTCCATTTTTGTC TACTGTTGTTACTGACAAGCTTTTTGTAATTGATGCTTTGTATTCAGATAATATAAGCAAGGAAAACTGT GTTTTCAGAAGCTCACTGATTGGCATAGTTTGTGGTGTTTTCTATCCCAGTTCTTTGGCTTTTACTAAAA ATGGACGCCTGGCAACCAAGTATCATACCGTTCCACTGCCACCAAAAGGAAGGGTTTTAATCCATTGGAT GACGCTTTGTCAAACACAAATGAAATTAATGGCGATTCCTCTAGTCTTTCAGATTATGTTTGGAATATTA AATGGTCTATACCATTATGCAGTATTTGAAGAGACACTTGAGAAAACTATACATGAAGAGTAA |
| Restriction Sites | RsrII-NotI |
| ACCN | NM_018480 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_018480.4, NP_060950.3 |
| RefSeq Size | 1038 bp |
| RefSeq ORF | 693 bp |
| Locus ID | 55863 |
| UniProt ID | Q8IUX1 |
| Protein Families | Transmembrane |
| Gene Summary | This gene encodes a mitochondrial transmembrane protein which is a component of the mitochondrial complex I assembly complex. The encoded protein serves as an assembly factor that is required for formation of the membrane arm of the complex. It interacts with NADH dehydrogenase [ubiquinone] 1 alpha subcomplex assembly factor 13. Naturally occurring mutations in this gene are associated with isolated complex I deficiency. A pseudogene of this gene has been defined on chromosome 9. [provided by RefSeq, Apr 2017] Transcript Variant: This variant (1) encodes the longest isoform (a). |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC207500 | TMEM126B (Myc-DDK-tagged)-Human transmembrane protein 126B (TMEM126B), transcript variant 1 |
CNY 2,400.00 |
|
| RC207500L3 | Lenti ORF clone of Human transmembrane protein 126B (TMEM126B), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC207500L4 | Lenti ORF clone of Human transmembrane protein 126B (TMEM126B), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
| RG207500 | TMEM126B (tGFP-tagged) - Human transmembrane protein 126B (TMEM126B), transcript variant 1 |
CNY 4,370.00 |
其它TMEM126B产品
