United States
Germany
Japan
United Kingdom
China
Myosin (MYL4) (NM_001002841) Human Untagged Clone
CAT＃: SC321697
MYL4 (untagged)-Human myosin, light chain 4, alkali, atrial, embryonic (MYL4), transcript variant 1
CNY 2,400.00
CNY 3,990.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | ALC1; AMLC; GT1; PRO1957 |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_001002841.1
CAGACGCCACGTCTCTCGGTTTCTTCTTAGATCACTCCTCTGCCAAAGATCCCAACAAGA
CAACATGGCTCCCAAGAAGCCTGAGCCTAAGAAGGAGGCAGCCAAGCCAGCTCCAGCTCC AGCTCCAGCCCCTGCACCAGCCCCTGCCCCAGCTCCTGAGGCTCCCAAGGAACCTGCCTT TGACCCCAAGAGTGTAAAGATAGACTTCACTGCCGACCAGATTGAAGAGTTCAAAGAGGC CTTTTCATTGTTTGACCGGACCCCGACTGGAGAGATGAAGATCACCTACGGCCAGTGCGG GGATGTACTGCGGGCCCTGGGCCAGAACCCTACCAATGCCGAGGTGCTGCGTGTGCTGGG CAAGCCCAAGCCTGAAGAGATGAATGTCAAGATGCTGGACTTTGAGACGTTCTTGCCCAT CCTGCAGCACATTTCCCGCAACAAGGAGCAGGGCACCTATGAGGACTTCGTGGAGGGCCT GCGTGTCTTTGACAAGGAGAGCAATGGCACGGTCATGGGTGCTGAGCTTCGGCACGTCCT TGCCACCCTGGGAGAGAAGATGACTGAGGCTGAAGTGGAGCAGCTGTTAGCTGGGCAAGA GGATGCCAATGGCTGCATCAATTATGAAGCCTTTGTCAAGCACATCATGTCAGGGTGAAG CAGAGTCTTCCAGGTGCCTGGCCCTTGGCTTTAGCCATACCAGGGTGAGTTAAAGAGAGG CCCCGGCTGGGTGAGCTGAGATGGAGTCCTCGACTTATCACCACACCACTGCCCCAAGGA CCTTACAGGCCCTCCCTGTTAATAAACAGCTCTAACACGGCCAGGCTGGGCTCTGGGATT CTGAAAAAAAAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_001002841 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001002841.1, NP_001002841.1 |
| RefSeq Size | 934 bp |
| RefSeq ORF | 594 bp |
| Locus ID | 4635 |
| UniProt ID | P12829 |
| Gene Summary | Myosin is a hexameric ATPase cellular motor protein. It is composed of two myosin heavy chains, two nonphosphorylatable myosin alkali light chains, and two phosphorylatable myosin regulatory light chains. This gene encodes a myosin alkali light chain that is found in embryonic muscle and adult atria. Two alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1) represents the longer transcript. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC206569 | MYL4 (Myc-DDK-tagged)-Human myosin, light chain 4, alkali, atrial, embryonic (MYL4), transcript variant 1 |
CNY 2,400.00 |
|
| RC206569L3 | Lenti ORF clone of Human myosin, light chain 4, alkali; atrial, embryonic (MYL4), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC206569L4 | Lenti ORF clone of Human myosin, light chain 4, alkali; atrial, embryonic (MYL4), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
| RG206569 | MYL4 (tGFP-tagged) - Human myosin, light chain 4, alkali; atrial, embryonic (MYL4), transcript variant 1 |
CNY 4,370.00 |
