United States
Germany
Japan
United Kingdom
China
LACRT (NM_033277) Human Untagged Clone
CAT＃: SC321633
LACRT (untagged)-Human lacritin (LACRT)
CNY 1,200.00
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_033277.1
GGGGATTCCCCAGACCTTCTGCAGATTCTGTGGTTATACTCACTCCTCATCCCAAAGAAT
GAAATTTACCACTCTCCTCTTCTTGGCAGCTGTAGCAGGGGCCCTGGTCTATGCTGAAGA TGCCTCCTCTGACTCGACGGGTGCTGATCCTGCCCAGGAAGCTGGGACCTCTAAGCCTAA TGAAGAGATCTCAGGTCCAGCAGAACCAGCTTCACCCCCAGAGACAACCACAACAGCCCA GGAGACTTCGGCGGCAGCAGTTCAGGGGACAGCCAAGGTCACCTCAAGCAGGCAGGAACT AAACCCCCTGAAATCCATAGTGGAGAAAAGTATCTTACTAACAGAACAAGCCCTTGCAAA AGCAGGAAAAGGAATGCACGGAGGCGTGCCAGGTGGAAAACAATTCATCGAAAATGGAAG TGAATTTGCACAAAAATTACTGAAGAAATTCAGTCTATTAAAACCATGGGCATGAGAAGC TGAAAAGAATGGGATCATTGGACTTAAAGCCTTAAATACCCTTGTAGCCCAGAGCTATTA AAACGAAAGCATCCATAAAAAAAAAAAAAAAAAAAAAAGAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_033277 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_033277.1, NP_150593.1 |
| RefSeq Size | 508 bp |
| RefSeq ORF | 417 bp |
| Locus ID | 90070 |
| UniProt ID | Q9GZZ8 |
| Protein Families | Secreted Protein |
| Gene Summary | The protein encoded by this gene is highly expressed in the lacrimal glands and localized primarily to secretory granules and secretory fluid. It augments lacrimal acinar cell secretion, promotes ductal cell proliferation, and stimulates signaling through tyrosine phosphorylation and release of calcium. [provided by RefSeq, Jul 2008] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC209355 | LACRT (Myc-DDK-tagged)-Human lacritin (LACRT) |
CNY 1,200.00 |
|
| RC209355L3 | Lenti ORF clone of Human lacritin (LACRT), Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC209355L4 | Lenti ORF clone of Human lacritin (LACRT), mGFP tagged |
CNY 5,890.00 |
|
| RG209355 | LACRT (tGFP-tagged) - Human lacritin (LACRT) |
CNY 2,800.00 |
