United States
Germany
Japan
United Kingdom
China
HSPC150 (UBE2T) (NM_014176) Human Untagged Clone
CAT＃: SC321551
UBE2T (untagged)-Human ubiquitin-conjugating enzyme E2T (putative) (UBE2T)
CNY 2,400.00
CNY 2,950.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | FANCT; HSPC150; PIG50 |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_014176.1
GCGCGTTGCTGCGTTGTGAGGGGTGTCAGCTCAGTGCATCCCAGGCAGCTCTTAGTGTGG
AGCAGTGAACTGTGTGTGGTTCCTTCTACTTGGGGATCATGCAGAGAGCTTCACGTCTGA AGAGAGAGCTGCACATGTTAGCCACAGAGCCACCCCCAGGCATCACATGTTGGCAAGATA AAGACCAAATGGATGACCTGCGAGCTCAAATATTAGGTGGAGCCAACACACCTTATGAGA AAGGTGTTTTTAAGCTAGAAGTTATCATTCCTGAGAGGTACCCATTTGAACCTCCTCAGA TCCGATTTCTCACTCCAATTTATCATCCAAACATTGATTCTGCTGGAAGGATTTGTCTGG ATGTTCTCAAATTGCCACCAAAAGGTGCTTGGAGACCATCCCTCAACATCGCAACTGTGT TGACCTCTATTCAGCTGCTCATGTCAGAACCCAACCCTGATGACCCGCTCATGGCTGACA TATCCTCAGAATTTAAATATAATAAGCCAGCCTTCCTCAAGAATGCCAGACAGTGGACAG AGAAGCATGCAAGACAGAAACAAAAGGCTGATGAGGAAGAGATGCTTGATAATCTACCAG AGGCTGGTGACTCCAGAGTACACAACTCAACACAGAAAAGGAAGGCCAGTCAGCTAGTAG GCATAGAAAAGAAATTTCATCCTGATGTTTAGGGGACTTGTCCTGGTTCATCTTAGTTAA TGTGTTCTTTGCCAAGGTGATCTAAGTTGCCTACCTTGAATTTTTTTTTAAATATATTTG ATGACATAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_014176 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_014176.1, NP_054895.1 |
| RefSeq Size | 928 bp |
| RefSeq ORF | 594 bp |
| Locus ID | 29089 |
| UniProt ID | Q9NPD8 |
| Domains | UBCc |
| Protein Families | Druggable Genome |
| Gene Summary | The protein encoded by this gene catalyzes the covalent attachment of ubiquitin to protein substrates. Defects in this gene have been associated with Fanconi anemia of complementation group T. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2015] Transcript Variant: This variant (1) encodes the longer isoform (1). |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC200748 | UBE2T (Myc-DDK-tagged)-Human ubiquitin-conjugating enzyme E2T (putative) (UBE2T) |
CNY 2,400.00 |
|
| RC200748L1 | Lenti ORF clone of Human ubiquitin-conjugating enzyme E2T (putative) (UBE2T), Myc-DDK-tagged |
CNY 4,800.00 |
|
| RC200748L2 | Lenti ORF clone of Human ubiquitin-conjugating enzyme E2T (putative) (UBE2T), mGFP tagged |
CNY 5,890.00 |
|
| RC200748L3 | Lenti ORF clone of Human ubiquitin-conjugating enzyme E2T (putative) (UBE2T), Myc-DDK-tagged |
CNY 4,800.00 |
|
| RC200748L4 | Lenti ORF clone of Human ubiquitin-conjugating enzyme E2T (putative) (UBE2T), mGFP tagged |
CNY 4,800.00 |
|
| RG200748 | UBE2T (tGFP-tagged) - Human ubiquitin-conjugating enzyme E2T (putative) (UBE2T) |
CNY 4,000.00 |
其它HSPC150产品
