COMMD5 (NM_001081004) Human Untagged Clone
CAT#: SC321508
COMMD5 (untagged)-Human COMM domain containing 5 (COMMD5), transcript variant 3
CNY 2,400.00
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | HCARG; HT002 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_001081004.1
GGCGCTTCCGGGGACCAGGCCCGCTTTTGGCTGCATCAGCCGGGGATTGCCGGCGCCAGG
CATCTGCATCTGGGACCGACCTCCTGGGCTGGCTGATCAAAGAGGAAGCAGCAGCAATGT CTGCTGTGGGGGCTGCAACTCCATACCTGCATCATCCTGGTGATAGTCACAGTGGCCGAG TGAGTTTCTTGGGGGCCCAGCTTCCTCCAGAGGTGGCAGCAATGGCCCGGCTACTAGGGG ACCTAGACAGGAGCACGTTCAGAAAGTTGCTGAAGTTTGTGGTCAGCAGCCTGCAGGGGG AGGACTGCCGAGAGGCTGTGCAGCGTCTTGGGGTCAGCGCCAACCTGCCGGAGGAGCAGC TGGGTGCCCTGCTGGCAGGCATGCACACACTGCTCCAGCAGGCCCTCCGTCTGCCCCCCA CCAGCCTGAAGCCTGACACCTTCAGGGACCAGCTCCAGGAGCTCTGCATCCCCCAAGACC TGGTCGGGGACTTGGCCAGCGTGGTATTTGGGAGCCAGCGGCCCCTCCTTGATTCTGTGG CCCAGCAGCAGGGGGCCTGGCTGCCGCATGTTGCTGACTTTCGGTGGCGGGTGGATGTAG CAATCTCCACCAGTGCCCTGGCTCGCTCCCTGCAGCCGAGCGTCCTGATGCAGCTGAAGC TTTCAGATGGGTCAGCATACCGCTTTGAGGTCCCCACAGCCAAGTTCCAGGAGCTGCGGT ACAGCGTGGCCCTGGTCCTAAAGGAGATGGCAGATCTGGAGAAGAGGTGTGAGCGCAGAC TGCAGGACTGACCCCTCACTTGACCAGTCCCATTCAGATCCGGCTTGGACAGGCACCTGA GATGGTGCCAAAGTGCAGCTGACTCTTCCCACGACAGCCCTGCCCTTCCCATGAGGCAGG CTCTTCAGTGAGTGTTTGAACGTAATTATGTAGTTTTCTGTTTAATTGAAAAAGAGAGCT ATGCCTTTTTTTCTTTTTGGAAGTAAAGCAGCTAAAAACAAAAAAAAAAAAAAAAAAAAA A |
Restriction Sites | Please inquire |
ACCN | NM_001081004 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001081004.1, NP_001074473.1 |
RefSeq Size | 1320 bp |
RefSeq ORF | 675 bp |
Locus ID | 28991 |
UniProt ID | Q9GZQ3 |
Protein Families | Druggable Genome |
Gene Summary | May modulate activity of cullin-RING E3 ubiquitin ligase (CRL) complexes (PubMed:21778237). Negatively regulates cell proliferation. Negatively regulates cell cycle G2/M phase transition probably by transactivating p21/CDKN1A through the p53/TP53-independent signaling pathway. Involved in kidney proximal tubule morphogenesis (By similarity). Down-regulates activation of NF-kappa-B (PubMed:15799966).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (3) differs in the 5' UTR, compared to variant 4. Variants 1 through 4 encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC201051 | COMMD5 (Myc-DDK-tagged)-Human COMM domain containing 5 (COMMD5), transcript variant 3 |
CNY 2,400.00 |
|
RC201051L3 | Lenti ORF clone of Human COMM domain containing 5 (COMMD5), transcript variant 3, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC201051L4 | Lenti ORF clone of Human COMM domain containing 5 (COMMD5), transcript variant 3, mGFP tagged |
CNY 5,890.00 |
|
RG201051 | COMMD5 (tGFP-tagged) - Human COMM domain containing 5 (COMMD5), transcript variant 3 |
CNY 4,000.00 |