CD38 (NM_001775) Human Untagged Clone
CAT#: SC321273
CD38 (untagged)-Human CD38 molecule (CD38)
CNY 2,400.00
CNY 2,950.00
Cited in 1 publication. |
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ADPRC 1; ADPRC1 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_001775.2
GCCTCCTGCCGGCCTCATCTTCGCCCAGCCAACCCCGCCTGGAGCCCTATGGCCAACTGC
GAGTTCAGCCCGGTGTCCGGGGACAAACCCTGCTGCCGGCTCTCTAGGAGAGCCCAACTC TGTCTTGGCGTCAGTATCCTGGTCCTGATCCTCGTCGTGGTGCTCGCGGTGGTCGTCCCG AGGTGGCGCCAGCAGTGGAGCGGTCCGGGCACCACCAAGCGCTTTCCCGAGACCGTCCTG GCGCGATGCGTCAAGTACACTGAAATTCATCCTGAGATGAGACATGTAGACTGCCAAAGT GTATGGGATGCTTTCAAGGGTGCATTTATTTCAAAACATCCTTGCAACATTACTGAAGAA GACTATCAGCCACTAATGAAGTTGGGAACTCAGACCGTACCTTGCAACAAGATTCTTCTT TGGAGCAGAATAAAAGATCTGGCCCATCAGTTCACACAGGTCCAGCGGGACATGTTCACC CTGGAGGACACGCTGCTAGGCTACCTTGCTGATGACCTCACATGGTGTGGTGAATTCAAC ACTTCCAAAATAAACTATCAATCTTGCCCAGACTGGAGAAAGGACTGCAGCAACAACCCT GTTTCAGTATTCTGGAAAACGGTTTCCCGCAGGTTTGCAGAAGCTGCCTGTGATGTGGTC CATGTGATGCTCAATGGATCCCGCAGTAAAATCTTTGACAAAAACAGCACTTTTGGGAGT GTGGAAGTCCATAATTTGCAACCAGAGAAGGTTCAGACACTAGAGGCCTGGGTGATACAT GGTGGAAGAGAAGATTCCAGAGACTTATGCCAGGATCCCACCATAAAAGAGCTGGAATCG ATTATAAGCAAAAGGAATATTCAATTTTCCTGCAAGAATATCTACAGACCTGACAAGTTT CTTCAGTGTGTGAAAAATCCTGAGGATTCATCTTGCACATCTGAGATCTGAGCCAGTCGC TGTGGTTGTTTTAGCTCCTTGACTCCTTGTGGTTTATGTCATCATACATGACTCAGCATA CCTGCTGGTGCAGAGCTGAAGATTTTGGAGGGTCCTCCACAATAAGGTCAATGCCAGAGA CGGAAGCCTTTTTCCCCAAAGTCTTAAAATAACTTATATCATCAGCATACCTTTATTGTG ATCTATCAATAGTCAAGAAAAATTATTGTATAAGATTAGAATGAAAATTGTATGTTAAGT TACTTCAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_001775 |
Insert Size | 903 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001775.2, NP_001766.2 |
RefSeq Size | 1494 bp |
RefSeq ORF | 903 bp |
Locus ID | 952 |
UniProt ID | P28907 |
Domains | Rib_hydrolayse |
Protein Families | Cancer stem cells, Druggable Genome, ES Cell Differentiation/IPS, Induced pluripotent stem cells, Transmembrane |
Protein Pathways | Calcium signaling pathway, Hematopoietic cell lineage, Metabolic pathways, Nicotinate and nicotinamide metabolism |
Gene Summary | The protein encoded by this gene is a non-lineage-restricted, type II transmembrane glycoprotein that synthesizes and hydrolyzes cyclic adenosine 5'-diphosphate-ribose, an intracellular calcium ion mobilizing messenger. The release of soluble protein and the ability of membrane-bound protein to become internalized indicate both extracellular and intracellular functions for the protein. This protein has an N-terminal cytoplasmic tail, a single membrane-spanning domain, and a C-terminal extracellular region with four N-glycosylation sites. Crystal structure analysis demonstrates that the functional molecule is a dimer, with the central portion containing the catalytic site. It is used as a prognostic marker for patients with chronic lymphocytic leukemia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015] Transcript Variant: This variant (1) represents the longer transcript and encodes the protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Citations (1)
The use of this cDNA Clones has been cited in the following citations: |
---|
Die Bedeutung der zellulären Volumenregulation bei der Kryo-Arretierung biologischer Systeme
,Christmann, J;,
Thesis
[CD38]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC203179 | CD38 (Myc-DDK-tagged)-Human CD38 molecule (CD38) |
CNY 3,600.00 |
|
RC203179L1 | Lenti ORF clone of Human CD38 molecule (CD38), Myc-DDK-tagged |
CNY 6,000.00 |
|
RC203179L2 | Lenti ORF clone of Human CD38 molecule (CD38), mGFP tagged |
CNY 6,000.00 |
|
RC203179L3 | Lenti ORF clone of Human CD38 molecule (CD38), Myc-DDK-tagged |
CNY 6,000.00 |
|
RC203179L4 | Lenti ORF clone of Human CD38 molecule (CD38), mGFP tagged |
CNY 6,000.00 |
|
RG203179 | CD38 (tGFP-tagged) - Human CD38 molecule (CD38) |
CNY 5,200.00 |